The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023618	Mycobacterium tuberculosis strain LN3695 chromosome, complete genome	4411449	889015	947579	4411449	bacteriocin,tRNA,protease,transposase	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889015_890276_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890331_891426_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891415_892213_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892209_893217_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893261_894563_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894574_894922_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894915_895572_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895763_898028_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898024_898654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898774_899731_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899675_901274_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901578_901968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902054_903638_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903668_904763_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904848_905031_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905177_906284_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906366_907236_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907281_907962_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908124_908427_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908428_909262_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909554_909977_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909973_910786_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910915_911683_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911679_912627_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912669_913446_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913501_914143_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914200_916255_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916420_917590_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917677_918694_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918855_919497_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919577_920633_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920684_921077_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921134_921557_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921518_921809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921913_922819_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922837_923653_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927780_930420_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930887_931532_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931512_932064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932213_932867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932937_933966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934654_935425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935511_936324_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936391_937252_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937527_937770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938046_939339_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939322_940327_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940390_941041_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941124_942402_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942614_944129_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944277_944670_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944872_945991_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945990_947250_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947246_947579_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023618	Mycobacterium tuberculosis strain LN3695 chromosome, complete genome	4411449	2941116	2976482	4411449	protease,capsid,head,transposase,terminase,integrase,tRNA	Tupanvirus(11.11%)	41	2969917:2969944	2980899:2980926
WP_003413486.1|2941116_2943195_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943303_2943531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943527_2944913_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945257_2945758_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945774_2946215_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946361_2947039_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947023_2947377_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947389_2947815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947811_2948486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948563_2949385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949520_2950414_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950416_2951235_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951249_2952431_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952489_2952921_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953434_2954676_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954985_2955348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955694_2956819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956820_2957360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957499_2958798_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958836_2959118_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959262_2959748_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959774_2960032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960032_2962369_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962397_2962640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962640_2963318_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963513_2964170_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964332_2964779_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964953_2965286_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965405_2965765_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965866_2966325_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966460_2966841_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966837_2968334_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968523_2968760_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968832_2969006_+	hypothetical protein	NA	NA	NA	NA	NA
2969917:2969944	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970050_2970482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970478_2971477_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971490_2971955_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972087_2973348_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973722_2975162_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975169_2975703_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975855_2976482_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980899:2980926	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
