The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023616	Mycobacterium tuberculosis strain LN3668 chromosome, complete genome	4411494	889043	947597	4411494	transposase,bacteriocin,tRNA,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889043_890304_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_096871945.1|890359_891454_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891443_892241_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892237_893245_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893289_894591_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894602_894950_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894943_895600_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895791_898056_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898052_898682_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898802_899759_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899703_901302_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901606_901996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902082_903666_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903696_904791_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904876_905059_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905205_906312_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906394_907264_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907309_907990_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908152_908455_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908456_909290_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909582_910005_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|910001_910814_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910943_911711_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911707_912655_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912697_913474_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913529_914171_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914228_916283_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916448_917618_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917686_918703_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918864_919506_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919586_920642_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920693_921086_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921143_921566_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921527_921818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921922_922828_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922846_923662_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927789_930438_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930905_931550_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931530_932082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932231_932885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932955_933984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934672_935443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935529_936342_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936409_937270_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937545_937788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938064_939357_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939340_940345_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940408_941059_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941142_942420_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942632_944147_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944295_944688_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_009935595.1|944890_946009_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|946008_947268_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947264_947597_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023616	Mycobacterium tuberculosis strain LN3668 chromosome, complete genome	4411494	2941166	2976532	4411494	integrase,head,protease,tRNA,capsid,transposase,terminase	Tupanvirus(11.11%)	41	2969967:2969994	2980949:2980976
WP_003413486.1|2941166_2943245_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943353_2943581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015575225.1|2943577_2944963_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945307_2945808_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945824_2946265_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946411_2947089_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947073_2947427_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947439_2947865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947861_2948536_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948613_2949435_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949570_2950464_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950466_2951285_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951299_2952481_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952539_2952971_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953484_2954726_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030030838.1|2955035_2955398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955744_2956869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956870_2957410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957549_2958848_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958886_2959168_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959312_2959798_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959824_2960082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960082_2962419_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962447_2962690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962690_2963368_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963563_2964220_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964382_2964829_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2965003_2965336_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965455_2965815_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965916_2966375_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966510_2966891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966887_2968384_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968573_2968810_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968882_2969056_+	hypothetical protein	NA	NA	NA	NA	NA
2969967:2969994	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970100_2970532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970528_2971527_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971540_2972005_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972137_2973398_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973772_2975212_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975219_2975753_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975905_2976532_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980949:2980976	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP023616	Mycobacterium tuberculosis strain LN3668 chromosome, complete genome	4411494	3710400	3796329	4411494	transposase,tRNA	Burkholderia_virus(28.57%)	57	NA	NA
WP_087902221.1|3710400_3711661_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3711716_3711878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003901601.1|3711899_3713429_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3713361_3714300_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003917150.1|3714308_3715676_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
WP_003417415.1|3715744_3716962_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3717057_3718566_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3718562_3719714_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3719904_3720750_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3721224_3721665_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3721698_3722568_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3722588_3723599_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3723883_3724516_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3724582_3725812_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3726094_3727444_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3727455_3728595_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3728591_3729323_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096879715.1|3729331_3736903_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3743165_3743423_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_009938649.1|3743678_3753152_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3753777_3754224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003900675.1|3754260_3755001_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3755295_3755583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009939158.1|3755919_3767070_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417738.1|3767313_3768108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3768189_3768561_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_157132559.1|3768458_3768677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417741.1|3768703_3768964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3769078_3769468_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3769481_3769775_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3769771_3770617_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3770740_3771016_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3771012_3771270_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3771311_3772502_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3772618_3772987_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3772983_3773535_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3773541_3774123_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3774103_3774472_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3774449_3774842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900676.1|3774838_3777469_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003417878.1|3777704_3778169_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010886167.1|3778535_3780302_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3780302_3780947_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3780945_3781380_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3781468_3784708_-	error-prone DNA polymerase DnaE2	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_003900036.1|3784899_3786240_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3786281_3787457_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3787510_3787615_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3787693_3788335_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3788335_3788584_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3788588_3790016_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3790123_3790777_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3790815_3792321_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3792325_3793216_-	diterpene synthase	NA	NA	NA	NA	NA
WP_096879716.1|3793224_3794835_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_075155233.1|3794779_3795025_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_087902221.1|3795067_3796329_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
