The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023615	Mycobacterium tuberculosis strain LN3589 chromosome, complete genome	4411392	889027	947591	4411392	bacteriocin,protease,transposase,tRNA	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889027_890288_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890343_891438_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891427_892225_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892221_893229_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893273_894575_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894586_894934_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894927_895584_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895775_898040_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898036_898666_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898786_899743_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899687_901286_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901590_901980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902066_903650_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903680_904775_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904860_905043_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905189_906296_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906378_907248_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907293_907974_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908136_908439_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908440_909274_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909566_909989_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909985_910798_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910927_911695_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911691_912639_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912681_913458_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913513_914155_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914212_916267_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916432_917602_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917689_918706_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918867_919509_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919589_920645_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920696_921089_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921146_921569_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921530_921821_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921925_922831_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922849_923665_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927792_930432_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930899_931544_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931524_932076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932225_932879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932949_933978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934666_935437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935523_936336_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936403_937264_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937539_937782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938058_939351_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939334_940339_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940402_941053_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941136_942414_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942626_944141_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944289_944682_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944884_946003_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|946002_947262_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947258_947591_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023615	Mycobacterium tuberculosis strain LN3589 chromosome, complete genome	4411392	2941065	2976431	4411392	capsid,head,transposase,tRNA,terminase,protease,integrase	Tupanvirus(11.11%)	42	2969866:2969893	2980848:2980875
WP_003413486.1|2941065_2943144_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943252_2943480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943476_2944862_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945206_2945707_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945723_2946164_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946310_2946988_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946972_2947326_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947338_2947764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947760_2948435_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948512_2949334_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949469_2950363_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950365_2951184_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951198_2952380_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952438_2952870_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953383_2954625_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954934_2955297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955643_2956768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956769_2957309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957448_2958747_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958785_2959067_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959211_2959697_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959723_2959981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959981_2962318_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962346_2962589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962589_2963267_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963462_2964119_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964281_2964728_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964902_2965235_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965354_2965714_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965815_2966274_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966409_2966790_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966786_2968283_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968472_2968709_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968781_2968955_+	hypothetical protein	NA	NA	NA	NA	NA
2969866:2969893	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969999_2970431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970427_2971426_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971439_2971904_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972036_2973297_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935348.1|2973324_2973510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973671_2975111_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975118_2975652_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975804_2976431_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980848:2980875	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
