The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023612	Mycobacterium tuberculosis strain LN2978 chromosome, complete genome	4411331	889002	947557	4411331	bacteriocin,transposase,tRNA,protease	Burkholderia_virus(16.67%)	52	NA	NA
WP_087902221.1|889002_890263_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890318_891413_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891402_892200_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892196_893204_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893248_894550_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894561_894909_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894902_895559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895750_898015_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_070895368.1|898011_898641_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898761_899718_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899662_901261_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901565_901955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902041_903625_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903655_904750_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904835_905018_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905164_906271_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906353_907223_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907268_907949_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908111_908414_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908415_909249_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909541_909964_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909960_910773_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910902_911670_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911666_912614_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912656_913433_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913488_914130_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914187_916242_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916407_917577_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917664_918681_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918842_919484_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919564_920620_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920671_921064_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921121_921544_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921505_921796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921900_922806_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922824_923640_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_003404362.1|930866_931511_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931491_932043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932192_932846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932916_933945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934633_935404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935490_936303_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936370_937231_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937506_937749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938025_939318_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939301_940306_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940369_941020_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941103_942381_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942593_944108_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944256_944649_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944851_945970_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404404.1|947224_947557_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023612	Mycobacterium tuberculosis strain LN2978 chromosome, complete genome	4411331	2941073	2976439	4411331	head,terminase,capsid,tRNA,integrase,transposase,protease	Tupanvirus(11.11%)	41	2969874:2969901	2980856:2980883
WP_003413486.1|2941073_2943152_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943260_2943488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943484_2944870_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945214_2945715_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945731_2946172_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946318_2946996_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946980_2947334_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947346_2947772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947768_2948443_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070890570.1|2948511_2949342_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949477_2950371_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950373_2951192_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951206_2952388_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952446_2952878_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953391_2954633_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954942_2955305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955651_2956776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956777_2957317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957456_2958755_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958793_2959075_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959219_2959705_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959731_2959989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959989_2962326_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962354_2962597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962597_2963275_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963470_2964127_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964289_2964736_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964910_2965243_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965362_2965722_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965823_2966282_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966417_2966798_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966794_2968291_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968480_2968717_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_128882533.1|2968789_2968963_+	hypothetical protein	NA	NA	NA	NA	NA
2969874:2969901	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970007_2970439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970435_2971434_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971447_2971912_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096868035.1|2972044_2973305_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973679_2975119_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975126_2975660_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975812_2976439_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980856:2980883	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
