The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023608	Mycobacterium tuberculosis strain LE410 chromosome, complete genome	4411365	889005	947561	4411365	bacteriocin,tRNA,protease,transposase	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889005_890266_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_096871945.1|890321_891416_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891405_892203_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892199_893207_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893251_894553_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894564_894912_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894905_895562_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895753_898018_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898014_898644_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898764_899721_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899665_901264_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901568_901958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902044_903628_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903658_904753_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904838_905021_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905167_906274_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906356_907226_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907271_907952_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908114_908417_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908418_909252_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909544_909967_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909963_910776_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910905_911673_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911669_912617_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912659_913436_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913491_914133_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914190_916245_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916410_917580_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917650_918667_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918828_919470_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919550_920606_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920657_921050_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921107_921530_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921491_921782_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921886_922792_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922810_923626_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927753_930402_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930869_931514_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931494_932046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932195_932849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932919_933948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934636_935407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935493_936306_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936373_937234_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937509_937752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938028_939321_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939304_940309_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940372_941023_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941106_942384_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942596_944111_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944259_944652_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_009935595.1|944854_945973_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945972_947232_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947228_947561_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023608	Mycobacterium tuberculosis strain LE410 chromosome, complete genome	4411365	2941097	2976463	4411365	protease,capsid,transposase,integrase,tRNA,terminase,head	Tupanvirus(11.11%)	41	2969898:2969925	2980879:2980906
WP_003413486.1|2941097_2943176_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943284_2943512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943508_2944894_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945238_2945739_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945755_2946196_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946342_2947020_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947004_2947358_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947370_2947796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947792_2948467_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948544_2949366_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949501_2950395_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950397_2951216_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951230_2952412_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952470_2952902_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953415_2954657_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030030838.1|2954966_2955329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955675_2956800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956801_2957341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957480_2958779_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958817_2959099_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959243_2959729_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959755_2960013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960013_2962350_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962378_2962621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962621_2963299_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963494_2964151_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964313_2964760_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964934_2965267_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965386_2965746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965847_2966306_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966441_2966822_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966818_2968315_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968504_2968741_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968813_2968987_+	hypothetical protein	NA	NA	NA	NA	NA
2969898:2969925	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970031_2970463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970459_2971458_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971471_2971936_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972068_2973329_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973703_2975143_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975150_2975684_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975836_2976463_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980879:2980906	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
