The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023603	Mycobacterium tuberculosis strain LE63 chromosome, complete genome	4411415	889057	947612	4411415	protease,transposase,tRNA,bacteriocin	Burkholderia_virus(16.67%)	52	NA	NA
WP_087902221.1|889057_890318_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890373_891468_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891457_892255_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892251_893259_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893303_894605_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894616_894964_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894957_895614_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895805_898070_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898066_898696_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898816_899773_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899717_901316_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901620_902010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902096_903680_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903710_904805_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904890_905073_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905219_906326_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906408_907278_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907323_908004_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908166_908469_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908470_909304_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909596_910019_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|910015_910828_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910957_911725_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911721_912669_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912711_913488_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913543_914185_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914242_916297_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916462_917632_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917719_918736_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918897_919539_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919619_920675_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920726_921119_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921176_921599_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921560_921851_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921955_922861_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922879_923695_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_003404362.1|930921_931566_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931546_932098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932247_932901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932971_934000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934688_935459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935545_936358_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936425_937286_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937561_937804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938080_939373_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939356_940361_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940424_941075_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941158_942436_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942648_944163_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944311_944704_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944906_946025_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947279_947612_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023603	Mycobacterium tuberculosis strain LE63 chromosome, complete genome	4411415	2941110	2976476	4411415	terminase,head,integrase,transposase,protease,tRNA,capsid	Tupanvirus(11.11%)	42	2969911:2969938	2980893:2980920
WP_003413486.1|2941110_2943189_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943297_2943525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943521_2944907_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945251_2945752_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945768_2946209_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946355_2947033_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947017_2947371_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947383_2947809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947805_2948480_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070890570.1|2948548_2949379_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949514_2950408_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950410_2951229_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951243_2952425_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952483_2952915_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953428_2954670_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954979_2955342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955688_2956813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956814_2957354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957493_2958792_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958830_2959112_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959256_2959742_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959768_2960026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960026_2962363_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962391_2962634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962634_2963312_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963507_2964164_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964326_2964773_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964947_2965280_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965399_2965759_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965860_2966319_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966454_2966835_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966831_2968328_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968517_2968754_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_128882533.1|2968826_2969000_+	hypothetical protein	NA	NA	NA	NA	NA
2969911:2969938	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970044_2970476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970472_2971471_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971484_2971949_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096868035.1|2972081_2973342_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935348.1|2973369_2973555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973716_2975156_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975163_2975697_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975849_2976476_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980893:2980920	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
