The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023593	Mycobacterium tuberculosis strain SLM040 chromosome, complete genome	4411408	889002	947566	4411408	tRNA,transposase,bacteriocin,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889002_890263_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890318_891413_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891402_892200_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892196_893204_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893248_894550_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894561_894909_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894902_895559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895750_898015_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898011_898641_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898761_899718_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899662_901261_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901565_901955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902041_903625_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903655_904750_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904835_905018_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905164_906271_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906353_907223_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907268_907949_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908111_908414_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908415_909249_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909541_909964_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909960_910773_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910902_911670_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911666_912614_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912656_913433_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913488_914130_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914187_916242_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916407_917577_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917664_918681_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918842_919484_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919564_920620_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920671_921064_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921121_921544_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921505_921796_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921900_922806_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922824_923640_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927767_930407_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930874_931519_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931499_932051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932200_932854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932924_933953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934641_935412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935498_936311_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936378_937239_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937514_937757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938033_939326_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939309_940314_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940377_941028_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941111_942389_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942601_944116_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944264_944657_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944859_945978_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945977_947237_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947233_947566_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023593	Mycobacterium tuberculosis strain SLM040 chromosome, complete genome	4411408	2941122	2976488	4411408	capsid,transposase,head,integrase,tRNA,protease,terminase	Tupanvirus(11.11%)	41	2969923:2969950	2980905:2980932
WP_003413486.1|2941122_2943201_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943309_2943537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943533_2944919_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945263_2945764_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945780_2946221_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946367_2947045_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947029_2947383_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947395_2947821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947817_2948492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948569_2949391_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949526_2950420_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950422_2951241_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951255_2952437_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952495_2952927_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953440_2954682_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954991_2955354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955700_2956825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956826_2957366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957505_2958804_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958842_2959124_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959268_2959754_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959780_2960038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960038_2962375_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962403_2962646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962646_2963324_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963519_2964176_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964338_2964785_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964959_2965292_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965411_2965771_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965872_2966331_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966466_2966847_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966843_2968340_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968529_2968766_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968838_2969012_+	hypothetical protein	NA	NA	NA	NA	NA
2969923:2969950	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970056_2970488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970484_2971483_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971496_2971961_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972093_2973354_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_096874181.1|2973728_2975168_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975175_2975709_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975861_2976488_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980905:2980932	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
