The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023586	Mycobacterium tuberculosis strain MDRMA2491 chromosome, complete genome	4411121	2940869	2976235	4411121	terminase,integrase,transposase,head,tRNA,protease,capsid	Tupanvirus(11.11%)	41	2969670:2969697	2980652:2980679
WP_003413486.1|2940869_2942948_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943056_2943284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096869134.1|2943280_2944666_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945010_2945511_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945527_2945968_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946114_2946792_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946776_2947130_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947142_2947568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2947564_2948239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948316_2949138_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949273_2950167_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950169_2950988_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951002_2952184_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952242_2952674_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953187_2954429_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954738_2955101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2955447_2956572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956573_2957113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957252_2958551_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958589_2958871_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959015_2959501_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959527_2959785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959785_2962122_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962150_2962393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962393_2963071_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963266_2963923_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964085_2964532_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964706_2965039_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965158_2965518_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965619_2966078_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966213_2966594_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966590_2968087_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968276_2968513_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968585_2968759_+	hypothetical protein	NA	NA	NA	NA	NA
2969670:2969697	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969803_2970235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970231_2971230_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971243_2971708_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2971840_2973101_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003901443.1|2973475_2974915_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2974922_2975456_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975608_2976235_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980652:2980679	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP023586	Mycobacterium tuberculosis strain MDRMA2491 chromosome, complete genome	4411121	3710099	3795993	4411121	tRNA,transposase	Burkholderia_virus(28.57%)	56	NA	NA
WP_087902221.1|3710099_3711360_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3711415_3711577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3711598_3713128_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3713060_3713999_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3714007_3715375_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3715443_3716661_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3716756_3718265_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3718261_3719413_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3719603_3720449_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3720923_3721364_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3721397_3722267_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3722287_3723298_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3723582_3724215_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3724281_3725511_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3725793_3727143_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3727154_3728294_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3728290_3729022_+	methyltransferase	NA	NA	NA	NA	NA
WP_096869140.1|3729030_3736602_-	PPE family protein	NA	NA	NA	NA	NA
WP_157756006.1|3736650_3742398_-	PE domain-containing protein	NA	NA	NA	NA	NA
WP_003417619.1|3742828_3743086_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3743341_3752815_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3753440_3753887_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003911006.1|3753923_3754664_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3754958_3755246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3766975_3767770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3767851_3768223_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_157132559.1|3768120_3768339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417741.1|3768365_3768626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3768740_3769130_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3769143_3769437_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3769433_3770279_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3770402_3770678_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3770674_3770932_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3770973_3772164_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3772280_3772649_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3772645_3773197_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3773203_3773785_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3773765_3774134_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3774111_3774504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3774500_3777131_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3777366_3777831_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010886167.1|3778197_3779964_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3779964_3780609_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3780607_3781042_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_070891160.1|3781130_3784370_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.3	2.1e-118
WP_003900036.1|3784561_3785902_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3785943_3787119_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3787172_3787277_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3787355_3787997_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3787997_3788246_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3788250_3789678_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3789785_3790439_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3790477_3791983_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3791987_3792878_-	diterpene synthase	NA	NA	NA	NA	NA
WP_078750126.1|3792886_3794680_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_087902221.1|3794731_3795993_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
