The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023583	Mycobacterium tuberculosis strain MDRDM260 chromosome, complete genome	4411280	888997	947552	4411280	bacteriocin,protease,transposase,tRNA	Burkholderia_virus(16.67%)	53	NA	NA
WP_087902221.1|888997_890258_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890313_891408_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891397_892195_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892191_893199_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_031658839.1|893243_894545_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894556_894904_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894897_895554_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895745_898010_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898006_898636_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898756_899713_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899657_901256_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901560_901950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902036_903620_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903650_904745_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904830_905013_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905159_906266_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906348_907218_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907263_907944_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908106_908409_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908410_909244_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909536_909959_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909955_910768_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910897_911665_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911661_912609_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912651_913428_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913483_914125_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914182_916237_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916402_917572_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917659_918676_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918837_919479_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919560_920616_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920667_921060_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921117_921540_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921501_921792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921896_922802_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922820_923636_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_031658840.1|927763_930394_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930861_931506_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931486_932038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932187_932841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932911_933940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934628_935399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935485_936298_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936365_937226_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937501_937744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938020_939313_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939296_940301_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940364_941015_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941098_942376_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942588_944103_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944251_944644_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944846_945965_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947219_947552_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023583	Mycobacterium tuberculosis strain MDRDM260 chromosome, complete genome	4411280	2941004	2976370	4411280	protease,capsid,terminase,transposase,integrase,head,tRNA	Tupanvirus(11.11%)	41	2969805:2969832	2980787:2980814
WP_003413486.1|2941004_2943083_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943191_2943419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943415_2944801_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945145_2945646_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945662_2946103_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946249_2946927_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946911_2947265_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947277_2947703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947699_2948374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948451_2949273_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949408_2950302_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950304_2951123_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951137_2952319_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952377_2952809_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953322_2954564_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954873_2955236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955582_2956707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956708_2957248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957387_2958686_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958724_2959006_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959150_2959636_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959662_2959920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959920_2962257_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962285_2962528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962528_2963206_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963401_2964058_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964220_2964667_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964841_2965174_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965293_2965653_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965754_2966213_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966348_2966729_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966725_2968222_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968411_2968648_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968720_2968894_+	hypothetical protein	NA	NA	NA	NA	NA
2969805:2969832	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969938_2970370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970366_2971365_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971378_2971843_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096868035.1|2971975_2973236_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973610_2975050_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975057_2975591_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975743_2976370_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980787:2980814	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
