The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023580	Mycobacterium tuberculosis strain LN180 chromosome, complete genome	4411436	889009	947573	4411436	protease,transposase,bacteriocin,tRNA	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889009_890270_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890325_891420_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891409_892207_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892203_893211_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893255_894557_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894568_894916_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894909_895566_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895757_898022_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898018_898648_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898768_899725_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899669_901268_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901572_901962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902048_903632_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903662_904757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904842_905025_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905171_906278_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906360_907230_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907275_907956_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908118_908421_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908422_909256_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909548_909971_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909967_910780_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910909_911677_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911673_912621_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912663_913440_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913495_914137_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914194_916249_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916414_917584_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917671_918688_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918849_919491_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919571_920627_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920678_921071_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921128_921551_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921512_921803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921907_922813_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922831_923647_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927774_930414_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930881_931526_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931506_932058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932207_932861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932931_933960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934648_935419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935505_936318_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936385_937246_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937521_937764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938040_939333_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939316_940321_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940384_941035_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941118_942396_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942608_944123_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944271_944664_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944866_945985_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945984_947244_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947240_947573_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023580	Mycobacterium tuberculosis strain LN180 chromosome, complete genome	4411436	2941116	2976482	4411436	capsid,protease,head,terminase,integrase,transposase,tRNA	Tupanvirus(11.11%)	41	2969917:2969944	2980899:2980926
WP_003413486.1|2941116_2943195_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943303_2943531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943527_2944913_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945257_2945758_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945774_2946215_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946361_2947039_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947023_2947377_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947389_2947815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947811_2948486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948563_2949385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949520_2950414_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950416_2951235_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951249_2952431_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952489_2952921_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953434_2954676_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954985_2955348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955694_2956819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956820_2957360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957499_2958798_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958836_2959118_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959262_2959748_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959774_2960032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960032_2962369_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962397_2962640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962640_2963318_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963513_2964170_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964332_2964779_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964953_2965286_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965405_2965765_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965866_2966325_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966460_2966841_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966837_2968334_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968523_2968760_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968832_2969006_+	hypothetical protein	NA	NA	NA	NA	NA
2969917:2969944	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970050_2970482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970478_2971477_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971490_2971955_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972087_2973348_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973722_2975162_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975169_2975703_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975855_2976482_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980899:2980926	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
