The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023577	Mycobacterium tuberculosis strain CSV11678 chromosome, complete genome	4411382	2941111	2976477	4411382	transposase,capsid,terminase,integrase,head,tRNA,protease	Tupanvirus(11.11%)	41	2969912:2969939	2980894:2980921
WP_003413486.1|2941111_2943190_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943298_2943526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943522_2944908_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945252_2945753_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945769_2946210_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946356_2947034_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947018_2947372_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947384_2947810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947806_2948481_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948558_2949380_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949515_2950409_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950411_2951230_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951244_2952426_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952484_2952916_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953429_2954671_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954980_2955343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955689_2956814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956815_2957355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957494_2958793_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958831_2959113_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959257_2959743_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959769_2960027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023641613.1|2960027_2962364_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962392_2962635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962635_2963313_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963508_2964165_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964327_2964774_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964948_2965281_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965400_2965760_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965861_2966320_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966455_2966836_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966832_2968329_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968518_2968755_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968827_2969001_+	hypothetical protein	NA	NA	NA	NA	NA
2969912:2969939	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970045_2970477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970473_2971472_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971485_2971950_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972082_2973343_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973717_2975157_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975164_2975698_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975850_2976477_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980894:2980921	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
