The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023576	Mycobacterium tuberculosis strain CSV10399 chromosome, complete genome	4411180	888867	947431	4411180	transposase,bacteriocin,tRNA,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_096867877.1|888867_890128_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.8	6.2e-82
WP_009935676.1|890183_891278_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891267_892065_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892061_893069_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893113_894415_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894426_894774_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894767_895424_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895615_897880_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|897876_898506_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898626_899583_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899527_901126_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901430_901820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|901906_903490_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903520_904615_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904700_904883_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905029_906136_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906218_907088_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907133_907814_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|907976_908279_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908280_909114_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909406_909829_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909825_910638_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910767_911535_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911531_912479_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912521_913298_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913353_913995_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914052_916107_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916272_917442_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917529_918546_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|918707_919349_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919429_920485_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920536_920929_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|920986_921409_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921370_921661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921765_922671_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922689_923505_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010924308.1|927632_930272_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930739_931384_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931364_931916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932065_932719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932789_933818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934506_935277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935363_936176_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936243_937104_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937379_937622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|937898_939191_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939174_940179_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940242_940893_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|940976_942254_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942466_943981_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944129_944522_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944724_945843_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|945842_947102_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947098_947431_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023576	Mycobacterium tuberculosis strain CSV10399 chromosome, complete genome	4411180	2940918	2976284	4411180	tRNA,protease,transposase,integrase,head,capsid,terminase	Tupanvirus(11.11%)	41	2969719:2969746	2980701:2980728
WP_003413486.1|2940918_2942997_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943105_2943333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943329_2944715_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945059_2945560_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945576_2946017_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_010924555.1|2946163_2946841_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946825_2947179_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947191_2947617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947613_2948288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948365_2949187_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949322_2950216_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950218_2951037_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951051_2952233_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952291_2952723_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953236_2954478_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954787_2955150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955496_2956621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956622_2957162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957301_2958600_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958638_2958920_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959064_2959550_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959576_2959834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023641824.1|2959834_2962171_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962199_2962442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962442_2963120_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963315_2963972_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964134_2964581_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964755_2965088_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965207_2965567_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965668_2966127_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966262_2966643_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966639_2968136_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968325_2968562_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968634_2968808_+	hypothetical protein	NA	NA	NA	NA	NA
2969719:2969746	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969852_2970284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970280_2971279_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971292_2971757_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096867877.1|2971889_2973150_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.8	6.2e-82
WP_003899411.1|2973524_2974964_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2974971_2975505_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975657_2976284_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980701:2980728	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
