The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023575	Mycobacterium tuberculosis strain CSV5769 chromosome, complete genome	4411312	888987	947542	4411312	tRNA,bacteriocin,protease,transposase	Burkholderia_virus(16.67%)	52	NA	NA
WP_087902221.1|888987_890248_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890303_891398_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891387_892185_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892181_893189_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893233_894535_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894546_894894_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894887_895544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895735_898000_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|897996_898626_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898746_899703_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899647_901246_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901550_901940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902026_903610_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903640_904735_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904820_905003_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905149_906256_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906338_907208_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907253_907934_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908096_908399_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908400_909234_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909526_909949_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909945_910758_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910887_911655_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911651_912599_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912641_913418_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913473_914115_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914172_916227_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916392_917562_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917649_918666_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918827_919469_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919549_920605_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920656_921049_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921106_921529_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921490_921781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921885_922791_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922809_923625_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_003404362.1|930851_931496_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931476_932028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932177_932831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932901_933930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934618_935389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935475_936288_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936355_937216_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937491_937734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938010_939303_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939286_940291_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940354_941005_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941088_942366_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942578_944093_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944241_944634_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944836_945955_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404404.1|947209_947542_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023575	Mycobacterium tuberculosis strain CSV5769 chromosome, complete genome	4411312	2941031	2976397	4411312	head,protease,integrase,tRNA,terminase,capsid,transposase	Tupanvirus(11.11%)	42	2969832:2969859	2980814:2980841
WP_003413486.1|2941031_2943110_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943218_2943446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865846.1|2943442_2944828_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945172_2945673_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945689_2946130_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946276_2946954_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946938_2947292_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947304_2947730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947726_2948401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070890570.1|2948469_2949300_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949435_2950329_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950331_2951150_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951164_2952346_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952404_2952836_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953349_2954591_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2954900_2955263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955609_2956734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956735_2957275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957414_2958713_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958751_2959033_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959177_2959663_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959689_2959947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959947_2962284_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962312_2962555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962555_2963233_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963428_2964085_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964247_2964694_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964868_2965201_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965320_2965680_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965781_2966240_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966375_2966756_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966752_2968249_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968438_2968675_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_128882533.1|2968747_2968921_+	hypothetical protein	NA	NA	NA	NA	NA
2969832:2969859	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969965_2970397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970393_2971392_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971405_2971870_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972002_2973263_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935348.1|2973290_2973476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2973637_2975077_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975084_2975618_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975770_2976397_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980814:2980841	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
