The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	425	21687	4659467	head,plate,holin,integrase,tail,capsid	Bacillus_phage(64.71%)	23	18733:18747	22210:22224
WP_017474201.1|425_1580_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_048356129.1|1620_2118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|2120_2360_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_048356130.1|2364_2700_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	53.3	4.6e-24
WP_048356131.1|2696_3119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474196.1|3115_3460_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	2.1e-16
WP_048356132.1|3468_4050_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_048356133.1|4183_4519_+	hypothetical protein	NA	H0USX2	Bacillus_phage	34.8	2.2e-10
WP_048356134.1|4761_10062_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	43.0	1.7e-104
WP_096891703.1|10062_10884_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.9	5.3e-66
WP_096891704.1|10892_12419_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.9	4.5e-50
WP_048356137.1|12440_15008_+	peptidase G2	NA	D6R401	Bacillus_phage	65.2	0.0e+00
WP_096891705.1|15020_16385_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	49.6	2.0e-62
WP_048355856.1|16399_16684_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	5.6e-15
WP_057957610.1|16685_16907_+	XkdX family protein	NA	NA	NA	NA	NA
WP_046132536.1|16910_17117_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	47.9	8.7e-10
WP_096891706.1|17187_18129_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	63.2	2.1e-95
WP_048356427.1|18154_18385_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	57.7	7.4e-18
WP_053071214.1|18514_18862_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	41.0	8.7e-10
18733:18747	attL	TGGAAATTCTAAAGT	NA	NA	NA	NA
WP_048356428.1|18895_19102_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096891707.1|19241_20060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048356430.1|20167_20461_+	YolD-like family protein	NA	O64030	Bacillus_phage	32.1	8.3e-06
WP_048350807.1|20541_21687_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.7	4.7e-44
22210:22224	attR	TGGAAATTCTAAAGT	NA	NA	NA	NA
>prophage 2
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	462865	501166	4659467	integrase,tail	Bacillus_phage(87.1%)	47	472276:472292	501391:501407
WP_096891732.1|462865_467773_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	60.1	0.0e+00
WP_082142529.1|468091_468508_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	86.6	5.8e-53
WP_048354010.1|468778_470173_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	57.5	8.9e-106
WP_048354011.1|470260_470512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082142528.1|470544_471240_-	hypothetical protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	46.2	1.8e-30
WP_048354012.1|471236_471467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354013.1|471672_471912_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048354014.1|471961_472213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048354015.1|472228_472867_-	hypothetical protein	NA	Q37974	Bacillus_phage	32.1	1.4e-05
472276:472292	attL	TAAACCATGTGTCAATT	NA	NA	NA	NA
WP_157769083.1|472914_473343_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	35.9	1.1e-14
WP_096891734.1|473302_473599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053075386.1|473786_474407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048354016.1|474422_474695_+	DUF3986 family protein	NA	NA	NA	NA	NA
WP_048354017.1|475161_475620_-	hypothetical protein	NA	O64047	Bacillus_phage	42.9	2.1e-27
WP_156415980.1|475737_475881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057957572.1|475877_476591_-	hypothetical protein	NA	D2XR29	Bacillus_phage	32.6	8.5e-28
WP_048354041.1|476669_477149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354042.1|477748_478042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048354018.1|478574_479252_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_048354019.1|479389_480391_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.8	6.7e-172
WP_096891735.1|480405_480825_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	57.8	9.4e-43
WP_096891736.1|480824_481307_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	33.5	3.9e-16
WP_046132693.1|481345_481537_-	XkdX family protein	NA	NA	NA	NA	NA
WP_048354021.1|481533_481851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354022.1|481863_483495_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	28.1	9.7e-27
WP_048354023.1|483497_483863_-	hypothetical protein	NA	A0A1P8CWQ8	Bacillus_phage	47.7	7.9e-22
WP_048354024.1|483973_484354_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	50.6	5.2e-16
WP_048354025.1|484393_485188_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	41.4	6.1e-27
WP_096891737.1|485232_485952_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	44.2	8.5e-52
WP_046132687.1|485948_486479_-	hypothetical protein	NA	O64060	Bacillus_phage	62.5	5.0e-57
WP_096891738.1|486475_487135_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	67.8	3.4e-79
WP_096891739.1|487121_487364_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	49.4	2.1e-10
WP_006640196.1|487360_487759_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	63.6	2.0e-42
WP_006640195.1|487770_488241_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	81.4	2.5e-68
WP_048354028.1|488281_489298_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	83.4	6.6e-159
WP_048354029.1|489342_489945_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	83.5	5.8e-78
WP_048354030.1|489968_491408_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	66.1	3.8e-176
WP_048354031.1|491442_492963_-	hypothetical protein	NA	O64068	Bacillus_phage	83.2	3.9e-248
WP_006640190.1|492980_494750_-	SPBc2 prophage-derived protein YonF	NA	O64069	Bacillus_phage	92.4	0.0e+00
WP_006640189.1|494733_495666_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	77.3	5.2e-142
WP_006640188.1|495837_496035_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006640187.1|496060_496435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891740.1|496642_497029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891741.1|497074_498292_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	86.9	6.6e-206
WP_096891742.1|498304_498508_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	75.8	7.8e-19
WP_096891743.1|499159_499675_-	hypothetical protein	NA	L0L915	Bacillus_phage	49.1	7.2e-37
WP_009328364.1|500890_501166_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	74.4	3.9e-29
501391:501407	attR	AATTGACACATGGTTTA	NA	NA	NA	NA
>prophage 3
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	530612	538801	4659467		Bacillus_phage(66.67%)	15	NA	NA
WP_048356237.1|530612_530900_+	hypothetical protein	NA	A0A0S2MUU5	Bacillus_phage	47.4	3.5e-17
WP_157769086.1|530937_531108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891772.1|531155_531398_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	78.8	1.5e-29
WP_048406324.1|532266_532464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406325.1|532506_532710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474436.1|533243_533498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406327.1|533497_533692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891773.1|533778_534183_+	hypothetical protein	NA	K4JWE2	Caulobacter_phage	39.1	3.9e-22
WP_046132636.1|534224_534752_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	57.5	3.1e-51
WP_046132634.1|535076_535280_+	hypothetical protein	NA	A0A217ER53	Bacillus_phage	54.8	3.2e-12
WP_048355020.1|535346_536159_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	73.6	1.6e-115
WP_046132632.1|536251_536476_+	hypothetical protein	NA	O64132	Bacillus_phage	66.2	1.7e-22
WP_096891774.1|536472_536835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891775.1|536873_538064_+	hypothetical protein	NA	A0A1S6UA32	Serratia_phage	30.2	4.6e-42
WP_096891776.1|538153_538801_+	hypothetical protein	NA	A0A2H4JAD2	uncultured_Caudovirales_phage	51.4	7.2e-58
>prophage 4
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	547272	620970	4659467	head,terminase,plate,holin,portal,protease,integrase,tail,tRNA,capsid	Bacillus_phage(68.25%)	91	546322:546339	629839:629856
546322:546339	attL	TCAATCCCTTTAGATAAA	NA	NA	NA	NA
WP_096891782.1|547272_548742_+	DNA helicase	NA	A0A2R2ZGP1	Clostridioides_phage	29.9	1.1e-53
WP_096891783.1|548764_549787_+	hypothetical protein	NA	E0YIU8	Lactococcus_phage	31.3	1.1e-17
WP_096891784.1|549802_550870_+	hypothetical protein	NA	Q332G6	Clostridium_botulinum_C_phage	31.5	4.4e-36
WP_096891785.1|550879_552595_+	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	54.8	1.7e-175
WP_057957420.1|552594_553305_+	3D domain-containing protein	NA	O64147	Bacillus_phage	44.6	1.4e-38
WP_006640523.1|553309_553528_+	YorP family protein	NA	NA	NA	NA	NA
WP_048355944.1|553842_554427_+	hypothetical protein	NA	A7KV03	Bacillus_phage	42.4	9.7e-30
WP_048355945.1|554438_554636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082634606.1|554724_555486_+	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	57.1	1.2e-72
WP_156415958.1|556268_556439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892166.1|556918_557353_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	44.7	8.6e-15
WP_157769087.1|557860_558070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132577.1|558105_558297_+	hypothetical protein	NA	U5PY38	Bacillus_phage	45.2	1.5e-08
WP_096891787.1|558372_558639_+	hypothetical protein	NA	A0A1P8CX38	Bacillus_phage	89.8	1.1e-36
WP_006640513.1|558670_559015_+	hypothetical protein	NA	O64168	Bacillus_phage	86.4	4.0e-15
WP_046132575.1|559037_559295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891788.1|559356_559719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891789.1|559914_560259_+	antitoxin endoai	NA	O64171	Bacillus_phage	42.0	8.3e-13
WP_096891790.1|560258_560663_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S6ANL8	Bacillus_phage	62.4	6.7e-38
WP_096891791.1|560616_561345_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	87.4	9.4e-115
WP_096891792.1|561588_564126_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	84.4	0.0e+00
WP_096891793.1|564280_564499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891794.1|564553_565537_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	58.2	2.3e-100
WP_096891795.1|565577_566570_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	81.8	2.7e-149
WP_088273122.1|566569_566815_+	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	66.2	4.6e-26
WP_065894503.1|566820_567177_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	30.6	6.4e-08
WP_096891796.1|567224_567524_+	hypothetical protein	NA	A0A0A0RSF8	Bacillus_phage	38.0	3.9e-11
WP_096891797.1|567683_567977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891798.1|568020_568455_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	4.9e-71
WP_096891799.1|568533_568974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272885.1|569104_569392_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	44.2	2.9e-11
WP_088272884.1|569393_570245_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	42.5	1.3e-54
WP_096891800.1|570432_570798_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	46.0	5.3e-18
WP_096891801.1|570833_571055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891802.1|571055_571397_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	43.4	1.4e-15
WP_096891803.1|571503_572601_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	66.5	4.2e-127
WP_157769088.1|572597_572774_+	hypothetical protein	NA	R4JK48	Bacillus_phage	72.2	1.6e-12
WP_096891804.1|572880_573099_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	90.3	1.7e-27
WP_096891806.1|573755_574031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891807.1|574401_575478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891808.1|575754_576087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891809.1|576133_576574_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	66.9	8.6e-47
WP_006640476.1|576785_577388_+	hypothetical protein	NA	O64195	Bacillus_phage	81.3	4.9e-85
WP_048355954.1|577612_579298_+	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	22.7	2.9e-18
WP_082142499.1|579287_579695_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.7	1.7e-17
WP_048355955.1|579798_581061_+	GTPase HflX	NA	NA	NA	NA	NA
WP_048355968.1|581080_582346_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_048355956.1|582449_582857_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048355957.1|582913_584248_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_048355958.1|584364_585516_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	40.5	1.3e-70
WP_082634607.1|585556_586678_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_048406756.1|586661_587063_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	44.7	1.4e-11
WP_048406755.1|587140_587410_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.4	1.8e-18
WP_048355961.1|587524_588289_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	48.6	7.2e-49
WP_048355962.1|588303_588615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057957416.1|589194_589752_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.4e-70
WP_048356393.1|589755_590688_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.1	2.0e-154
WP_003185383.1|590687_591125_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
WP_057957417.1|591185_593606_+	DNA primase	NA	D6R422	Bacillus_phage	74.1	0.0e+00
WP_057957418.1|593885_594323_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	1.6e-61
WP_025807627.1|594319_594859_+	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
WP_017695850.1|594855_595026_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	5.1e-08
WP_048354670.1|595029_595545_+	hypothetical protein	NA	D6R425	Bacillus_phage	81.9	1.3e-81
WP_048354671.1|595560_595959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071584231.1|596071_596452_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.7e-43
WP_057957653.1|597192_597429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406900.1|597415_597673_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	62.7	9.8e-27
WP_053071264.1|597669_597978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891810.1|598321_598684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837717.1|598710_599085_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
WP_096891811.1|599312_599828_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.5	7.0e-32
WP_096891812.1|599824_601534_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.8	7.4e-211
WP_096891813.1|601545_601737_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_096891814.1|601737_603048_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.9	4.2e-105
WP_096891815.1|602992_603724_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	55.9	8.9e-57
WP_096891816.1|603762_605046_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.0	5.4e-81
WP_006637246.1|605069_605498_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	59.0	5.5e-14
WP_006637247.1|605518_605821_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	4.7e-12
WP_006637248.1|605810_606119_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	8.2e-12
WP_006637249.1|606118_606517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048354910.1|606513_606897_+	phage protein	NA	NA	NA	NA	NA
WP_048354911.1|606911_607529_+|tail	tail protein	tail	NA	NA	NA	NA
WP_006637252.1|607585_607951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891817.1|608159_612629_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	7.1e-72
WP_048407278.1|613476_615189_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.9	5.8e-224
WP_096891818.1|615223_617788_+	peptidase G2	NA	D6R401	Bacillus_phage	60.3	3.7e-307
WP_096891819.1|617800_619141_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.0	3.6e-64
WP_048356295.1|619155_619458_+	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
WP_006637259.1|619454_619631_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	8.5e-06
WP_096891820.1|619665_620076_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.0	3.9e-25
WP_096891821.1|620127_620970_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	56.7	8.7e-48
629839:629856	attR	TTTATCTAAAGGGATTGA	NA	NA	NA	NA
>prophage 5
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	2098522	2107109	4659467		Bacillus_phage(33.33%)	8	NA	NA
WP_048353262.1|2098522_2099251_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	3.4e-32
WP_048353326.1|2099401_2100169_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	27.1	7.8e-11
WP_048353263.1|2100232_2101252_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.9	1.3e-16
WP_048353264.1|2101252_2102317_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.9	3.4e-20
WP_048353265.1|2102466_2103873_-	amino acid permease	NA	NA	NA	NA	NA
WP_046129267.1|2104318_2104462_-	small, acid-soluble spore protein, SspJ family	NA	NA	NA	NA	NA
WP_048353266.1|2104685_2105156_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.1	7.1e-07
WP_057957533.1|2105249_2107109_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.4	2.9e-88
>prophage 6
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	2165033	2216108	4659467	head,terminase,plate,holin,protease,portal,integrase,tail,capsid	Bacillus_phage(39.53%)	69	2164601:2164622	2206332:2206353
2164601:2164622	attL	ATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_048353314.1|2165033_2165846_+	hypothetical protein	NA	A0A2I7SC66	Paenibacillus_phage	39.1	3.1e-18
WP_048353328.1|2165979_2166300_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	33.0	8.0e-10
WP_057957537.1|2166856_2167480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057957538.1|2167517_2168600_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	57.3	2.3e-48
WP_048356294.1|2168651_2168915_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	6.7e-31
WP_046129173.1|2168930_2169200_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	1.7e-21
WP_048356293.1|2169262_2169445_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	52.1	3.6e-07
WP_048356295.1|2169441_2169744_-	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
WP_096891892.1|2169758_2171099_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.7	4.3e-65
WP_057957580.1|2171111_2173676_-	peptidase G2	NA	D6R401	Bacillus_phage	60.5	3.7e-307
WP_096891893.1|2175434_2176271_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	9.8e-108
WP_096891894.1|2176270_2180740_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.6	5.5e-72
WP_006637252.1|2180948_2181314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354911.1|2181370_2181988_-|tail	tail protein	tail	NA	NA	NA	NA
WP_048354910.1|2182002_2182386_-	phage protein	NA	NA	NA	NA	NA
WP_048354909.1|2182382_2182781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354908.1|2182780_2183089_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	39.6	7.4e-13
WP_048354907.1|2183078_2183381_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	8.0e-12
WP_048354906.1|2183401_2183830_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.4	9.3e-14
WP_006637245.1|2183854_2185138_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.8	2.7e-80
WP_006637244.1|2185176_2185908_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.2	4.0e-57
WP_057957702.1|2185852_2187163_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.5	1.4e-105
WP_057957701.1|2187163_2187355_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_006637241.1|2187366_2189076_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	64.0	1.9e-211
WP_057957703.1|2189072_2189588_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	1.7e-33
WP_021837717.1|2189817_2190192_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
WP_006637238.1|2190218_2190533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053071265.1|2190519_2191080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053071264.1|2191307_2191616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406900.1|2191612_2191870_-	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	62.7	9.8e-27
WP_157769096.1|2191856_2192093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356389.1|2192448_2192631_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	88.3	3.8e-25
WP_046129156.1|2192688_2193105_+	pilus assembly protein HicB	NA	D6R430	Bacillus_phage	88.3	3.8e-68
WP_048356388.1|2193437_2193980_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_048356387.1|2193979_2194420_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	53.2	9.5e-38
WP_048356096.1|2194846_2195656_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.4	1.0e-90
WP_048406658.1|2195637_2196627_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	45.4	3.9e-63
WP_048406659.1|2196631_2196883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891896.1|2196882_2197131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406661.1|2197127_2197523_-	hypothetical protein	NA	A0A0A7RUP7	Clostridium_phage	45.0	2.3e-06
WP_048406662.1|2197519_2197753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406663.1|2197788_2197989_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	46.8	2.3e-07
WP_128748284.1|2198061_2198211_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_096891897.1|2198315_2198864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891898.1|2199187_2200021_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.7	2.9e-35
WP_096891899.1|2200004_2200874_-	replication protein	NA	V5UQV4	Oenococcus_phage	44.1	1.8e-43
WP_096891900.1|2200866_2201085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891901.1|2201138_2201519_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	9.1e-21
WP_048406865.1|2201712_2201931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406871.1|2201908_2202184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356484.1|2202302_2202701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356483.1|2202713_2203418_-	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	70.0	4.0e-86
WP_048356482.1|2203464_2203674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356481.1|2203673_2203877_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APY7	Phage_Wrath	56.7	3.5e-11
WP_046129141.1|2203913_2204105_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU05	Anoxybacillus_phage	55.7	1.3e-12
WP_048356480.1|2204264_2204681_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	54.8	1.0e-28
WP_048356479.1|2204703_2205147_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	63.4	5.4e-49
WP_048356478.1|2205195_2206260_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	64.3	1.6e-134
WP_048356477.1|2206806_2207280_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	62.5	2.7e-46
2206332:2206353	attR	ATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_048354929.1|2209708_2210455_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_048354930.1|2210572_2210803_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_048354936.1|2210962_2211247_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	50.0	3.2e-10
WP_096892181.1|2211276_2211462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048354931.1|2211662_2212067_+	transcriptional regulator	NA	S6C481	Thermus_phage	67.6	7.7e-18
WP_048354937.1|2212222_2212621_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	61.2	7.8e-15
WP_048354932.1|2212669_2213347_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048354933.1|2213368_2214286_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048354934.1|2214299_2214953_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048354935.1|2214965_2216108_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.5	3.9e-14
>prophage 7
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	2289158	2313634	4659467	head,terminase,plate,holin,protease,portal,tail,capsid	Bacillus_phage(47.37%)	24	NA	NA
WP_048350429.1|2289158_2289389_-|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	54.9	8.2e-17
WP_096891706.1|2289414_2290356_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	63.2	2.1e-95
WP_048406081.1|2290420_2290684_-|holin	holin	holin	NA	NA	NA	NA
WP_048355726.1|2290744_2291554_-	hypothetical protein	NA	D7RWE8	Brochothrix_phage	32.8	4.9e-40
WP_053071213.1|2291604_2293074_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	46.6	3.9e-67
WP_096891905.1|2293085_2295644_-	peptidase G2	NA	D6R401	Bacillus_phage	64.3	0.0e+00
WP_048406080.1|2295665_2297192_-	hypothetical protein	NA	A6M966	Geobacillus_virus	35.4	7.1e-48
WP_048356135.1|2297200_2298022_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.9	1.2e-65
WP_096891906.1|2298022_2303323_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	43.2	1.5e-100
WP_048356133.1|2303565_2303901_-	hypothetical protein	NA	H0USX2	Bacillus_phage	34.8	2.2e-10
WP_048356132.1|2304034_2304616_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_017474196.1|2304624_2304969_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	2.1e-16
WP_048356131.1|2304965_2305388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356130.1|2305384_2305720_-|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	53.3	4.6e-24
WP_017474199.1|2305724_2305964_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_048356129.1|2305966_2306464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474201.1|2306504_2307659_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_048356128.1|2307658_2308405_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	51.9	3.0e-60
WP_048356127.1|2308358_2309657_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.0	9.6e-86
WP_026699328.1|2309668_2311450_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	68.1	6.6e-247
WP_026699327.1|2311424_2311748_-|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	70.1	9.4e-35
WP_080626794.1|2311867_2312206_-	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_048356125.1|2312616_2312928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053075443.1|2313244_2313634_-	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
>prophage 8
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	2317574	2359122	4659467	integrase	Bacillus_phage(43.24%)	55	2313481:2313495	2353716:2353730
2313481:2313495	attL	CTTGCGGAATAATAT	NA	NA	NA	NA
WP_096891907.1|2317574_2318384_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.5	8.9e-98
WP_096891908.1|2318431_2318605_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	85.5	4.4e-23
WP_048407257.1|2318643_2318958_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_096891909.1|2320577_2321378_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	2.8e-72
WP_096891910.1|2321466_2321955_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	42.3	1.2e-20
WP_096891911.1|2321947_2322376_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_096891912.1|2322451_2322838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891913.1|2322826_2324179_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	71.4	2.5e-137
WP_048356231.1|2324175_2324739_-	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	47.2	6.7e-36
WP_048356232.1|2324735_2325656_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	55.2	7.6e-37
WP_096891914.1|2325854_2326445_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	61.4	1.7e-26
WP_096891915.1|2326414_2327245_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	66.8	1.9e-87
WP_096891916.1|2327245_2327473_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	76.4	5.1e-19
WP_096891917.1|2327472_2328054_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.7	2.0e-43
WP_082634695.1|2328108_2328846_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	61.2	6.0e-85
WP_048356312.1|2328835_2329807_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.1	4.4e-144
WP_048356313.1|2329845_2330184_-	DUF1140 family protein	NA	Q94M85	Lactococcus_phage	40.8	7.6e-11
WP_096891918.1|2330298_2330646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891919.1|2330642_2332742_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.7	0.0e+00
WP_096891920.1|2332731_2333088_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.1	7.7e-30
WP_096891921.1|2333087_2333429_-	DUF3307 domain-containing protein	NA	D2XQ28	Bacillus_virus	70.6	1.5e-38
WP_057957714.1|2333425_2333626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356259.1|2333622_2333880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356260.1|2333884_2334250_-	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	39.3	2.6e-12
WP_048356261.1|2334255_2334774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356262.1|2334770_2335091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057957715.1|2335090_2336140_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	7.5e-81
WP_096891922.1|2336154_2338401_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.6	3.0e-172
WP_156416014.1|2338434_2338599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891924.1|2338775_2340056_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	24.7	6.2e-21
WP_096891925.1|2340096_2340528_-	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	5.2e-12
WP_096891926.1|2340705_2341485_-	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	50.8	1.3e-58
WP_096891927.1|2341732_2342257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356585.1|2342553_2343081_-	hypothetical protein	NA	A0A2H4J6V7	uncultured_Caudovirales_phage	30.3	5.7e-13
WP_048356586.1|2343421_2343751_+	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	60.7	2.5e-27
WP_048356587.1|2343756_2344224_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	56.3	4.7e-43
WP_096891928.1|2344318_2345332_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.7	1.5e-73
WP_048356010.1|2345465_2346836_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.2	2.1e-123
WP_096891929.1|2346832_2347036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891930.1|2347035_2347365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891931.1|2347364_2347865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156416018.1|2348641_2348788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891932.1|2348803_2349181_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	44.2	1.3e-22
WP_048356308.1|2349532_2349937_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.7	3.3e-13
WP_157769099.1|2349937_2350111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096891933.1|2350124_2350511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356544.1|2350550_2350880_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	32.2	2.1e-05
WP_096891934.1|2350869_2351388_-	hypothetical protein	NA	K4NX74	Streptomyces_phage	53.1	1.2e-10
WP_048354999.1|2352040_2352490_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.1	3.3e-09
WP_048354998.1|2352710_2353697_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1JS84	Enterobacteria_phage	24.5	1.7e-13
WP_046131841.1|2354211_2354793_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	2.8e-53
2353716:2353730	attR	ATATTATTCCGCAAG	NA	NA	NA	NA
WP_048354997.1|2354850_2355450_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_048354996.1|2356166_2356490_+	hypothetical protein	NA	G3MBI9	Bacillus_virus	42.2	1.5e-16
WP_082634688.1|2356522_2357464_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_048354994.1|2357502_2359122_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.7	1.2e-42
>prophage 9
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	3388362	3394760	4659467	protease	Caulobacter_phage(50.0%)	7	NA	NA
WP_048354443.1|3388362_3388965_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	8.2e-24
WP_046130877.1|3388993_3389575_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.9	4.8e-29
WP_048354442.1|3389637_3390216_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.2	8.1e-29
WP_048405922.1|3390282_3391056_+	TerC family protein	NA	S5MAL1	Bacillus_phage	63.5	5.7e-78
WP_048354441.1|3391158_3392346_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_082142401.1|3392335_3393736_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	29.3	8.3e-11
WP_048354440.1|3393650_3394760_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	6.1e-41
>prophage 10
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	3706728	3765450	4659467	head,terminase,plate,holin,protease,portal,integrase,tail,tRNA,capsid,transposase	Bacillus_phage(57.78%)	71	3716993:3717014	3761108:3761129
WP_048356190.1|3706728_3707205_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_048356189.1|3707185_3707878_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_046132145.1|3707889_3708348_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_048356188.1|3708337_3709363_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	5.6e-65
WP_048356187.1|3709596_3711525_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	5.8e-63
WP_048356186.1|3711677_3712190_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_048356185.1|3712854_3713031_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_096891997.1|3713037_3713802_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_046132142.1|3713839_3714019_-	YdiK family protein	NA	NA	NA	NA	NA
WP_048356184.1|3714018_3714753_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|3714978_3715263_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_048356183.1|3715308_3716940_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	3.7e-159
3716993:3717014	attL	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
WP_048407299.1|3717021_3718239_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.1	3.4e-141
WP_096891998.1|3718252_3718885_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	60.5	3.0e-69
WP_009330102.1|3719049_3719298_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	67.1	5.0e-20
WP_034292464.1|3719320_3719521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048407301.1|3719532_3720279_+	antirepressor	NA	A0A0C5AFE7	Paenibacillus_phage	74.6	1.3e-100
WP_095259968.1|3720292_3720523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406866.1|3720650_3720926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048355806.1|3720979_3721294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096892000.1|3721348_3721618_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	57.0	2.4e-23
WP_057957666.1|3721815_3722373_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_048356391.1|3722376_3723309_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
WP_003185383.1|3723308_3723746_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
WP_096892002.1|3723806_3726239_+	DNA primase	NA	D6R422	Bacillus_phage	80.5	0.0e+00
WP_096892004.1|3726463_3726835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892006.1|3726812_3727250_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	77.9	1.0e-63
WP_096892008.1|3727246_3727786_+	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	5.0e-89
WP_096892009.1|3727782_3727953_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	65.1	1.4e-08
WP_096892011.1|3727956_3728472_+	hypothetical protein	NA	D6R425	Bacillus_phage	84.2	1.8e-83
WP_157769102.1|3728486_3728882_+	hypothetical protein	NA	Q5YA89	Bacillus_phage	43.5	3.9e-22
WP_096892014.1|3728881_3729298_+	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	58.3	1.4e-22
WP_096892016.1|3729428_3729743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892017.1|3729755_3730193_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	74.3	1.1e-54
WP_096892206.1|3730280_3730502_+	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.0	1.8e-08
WP_009330080.1|3730614_3730995_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	5.1e-48
WP_096892019.1|3731647_3731887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406900.1|3731873_3732131_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	62.7	9.8e-27
WP_053071264.1|3732127_3732436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892020.1|3732663_3733224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407363.1|3733210_3733525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892022.1|3733551_3733926_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	1.2e-28
WP_025807612.1|3734154_3734670_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	1.7e-33
WP_057957704.1|3734666_3736376_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	2.5e-206
WP_048353720.1|3736387_3736579_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_057957705.1|3736579_3737890_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.9	1.1e-105
WP_048354916.1|3737834_3738566_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.5	8.1e-58
WP_096892207.1|3738635_3739919_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.5	5.9e-80
WP_096892024.1|3739944_3740373_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.6	1.4e-14
WP_048354907.1|3740393_3740696_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	8.0e-12
WP_096892026.1|3740685_3740994_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	1.1e-11
WP_096892028.1|3740993_3741392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892030.1|3741388_3741772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892031.1|3741786_3742404_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096892032.1|3742460_3742826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892034.1|3743035_3747505_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	9.3e-72
WP_096891893.1|3747504_3748341_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	9.8e-108
WP_096892036.1|3748353_3750066_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	68.0	2.0e-224
WP_096891818.1|3750100_3752665_+	peptidase G2	NA	D6R401	Bacillus_phage	60.3	3.7e-307
WP_096891819.1|3752677_3754018_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.0	3.6e-64
WP_048356295.1|3754032_3754335_+	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
WP_006637259.1|3754331_3754508_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	8.5e-06
WP_096891820.1|3754542_3754953_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.0	3.9e-25
WP_096892038.1|3755004_3755847_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	56.7	8.7e-48
WP_048355050.1|3755881_3756298_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	58.0	3.5e-42
WP_096892040.1|3756309_3757959_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	49.6	9.1e-57
WP_035338316.1|3758211_3759333_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_048355879.1|3759555_3759876_-	YolD-like family protein	NA	O64030	Bacillus_phage	36.9	6.5e-12
WP_057957595.1|3762148_3762670_-	hypothetical protein	NA	NA	NA	NA	NA
3761108:3761129	attR	TTGCCCACATTTTGCCCACAGT	NA	NA	NA	NA
WP_048355055.1|3763447_3763786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057957594.1|3763803_3765450_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	3830253	3840148	4659467		Synechococcus_phage(50.0%)	9	NA	NA
WP_048354863.1|3830253_3831549_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	5.9e-19
WP_048354864.1|3831624_3832341_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.5	9.7e-48
WP_046130445.1|3832342_3832597_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_048354865.1|3832593_3833277_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_048405834.1|3833260_3835489_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	6.3e-162
WP_048354866.1|3835464_3836895_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.8e-51
WP_048354867.1|3836988_3838029_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	47.0	1.2e-62
WP_048354868.1|3838025_3838598_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.8	4.4e-27
WP_057957588.1|3838609_3840148_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	2.1e-76
>prophage 12
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	4387292	4422382	4659467	coat,transposase,protease	Pandoravirus(40.0%)	40	NA	NA
WP_048355695.1|4387292_4387745_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131187.1|4387906_4388389_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131186.1|4388520_4389027_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131185.1|4389094_4389451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048355696.1|4389498_4389885_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_082634656.1|4389999_4390413_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_048355698.1|4390707_4390917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948531.1|4390999_4391149_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_048355699.1|4391281_4391539_+	sporulation protein	NA	NA	NA	NA	NA
WP_048355700.1|4391579_4393859_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.0	4.4e-86
WP_048355701.1|4393976_4394234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048355702.1|4394283_4394871_-	DedA family protein	NA	NA	NA	NA	NA
WP_048355703.1|4394965_4395952_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.2	9.6e-54
WP_048355704.1|4396864_4397257_-	GtrA family protein	NA	NA	NA	NA	NA
WP_048355705.1|4397457_4397886_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048355706.1|4397895_4398405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048355707.1|4398470_4399193_-	esterase family protein	NA	NA	NA	NA	NA
WP_057957622.1|4399571_4400690_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.0	1.5e-15
WP_048355708.1|4400686_4401865_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.4	2.8e-20
WP_096892092.1|4402716_4403112_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_057957623.1|4403434_4403716_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_057957624.1|4403810_4404197_-	DUF2606 family protein	NA	NA	NA	NA	NA
WP_053075449.1|4404196_4404745_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_048356401.1|4405072_4405534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356403.1|4405898_4406144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356404.1|4406826_4407600_-	acetoin reductase	NA	NA	NA	NA	NA
WP_048356405.1|4408527_4408890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048356406.1|4408940_4409768_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048356407.1|4410398_4410875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131163.1|4411011_4411218_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_096892094.1|4411376_4412183_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048356409.1|4412439_4412649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356410.1|4412645_4413053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356411.1|4413129_4413459_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_048356412.1|4413913_4415533_-	APC family permease	NA	NA	NA	NA	NA
WP_156183641.1|4415637_4415775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356413.1|4416460_4417348_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048356414.1|4417588_4419415_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_057957625.1|4419441_4421160_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_085959889.1|4421219_4422382_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
>prophage 13
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	4425780	4471664	4659467	head,terminase,plate,holin,portal,protease,integrase,tail,coat,capsid	Bacillus_phage(82.61%)	58	4429744:4429803	4470279:4470338
WP_048356273.1|4425780_4426551_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	68.2	1.0e-26
WP_048356271.1|4426940_4427120_+	hypothetical protein	NA	D6R401	Bacillus_phage	50.9	6.2e-12
WP_048356270.1|4427157_4428579_-	multidrug efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.9	5.0e-19
WP_057957672.1|4428580_4429162_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048356269.1|4429269_4429683_-	hypothetical protein	NA	NA	NA	NA	NA
4429744:4429803	attL	TAATTTACAATCGTAGTAAATTTAATCAAACCTTATGAATACTGAAGGGAAAGGGGATAT	NA	NA	NA	NA
WP_048356268.1|4429804_4430977_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	29.1	9.1e-35
WP_048356267.1|4431108_4431531_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.3	2.4e-46
WP_057957673.1|4431541_4431970_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.0	7.1e-46
WP_048356265.1|4432238_4432424_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	67.2	5.6e-16
WP_048356264.1|4432425_4432698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048406871.1|4432873_4433149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048355806.1|4433202_4433517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048355807.1|4433571_4433841_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	56.3	1.8e-23
WP_048355808.1|4433934_4434204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057957666.1|4434269_4434827_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_048356391.1|4434830_4435763_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
WP_003185383.1|4435762_4436200_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
WP_057957665.1|4436260_4438678_+	DNA primase	NA	D6R422	Bacillus_phage	84.7	0.0e+00
WP_096892096.1|4439406_4439844_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	2.1e-61
WP_025807627.1|4439840_4440380_+	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
WP_071583658.1|4440376_4440547_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
WP_048350603.1|4440550_4441066_+	hypothetical protein	NA	D6R425	Bacillus_phage	83.0	3.3e-82
WP_048350602.1|4441081_4441480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185369.1|4441592_4441973_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
WP_006637235.1|4442711_4442936_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017474863.1|4443113_4443599_+	hypothetical protein	NA	A0A217EQZ2	Bacillus_phage	57.1	1.2e-09
WP_048407332.1|4443655_4443877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026080869.1|4444112_4444754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048350375.1|4444913_4445288_+	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	9.8e-60
WP_048355563.1|4445256_4445583_+	hypothetical protein	NA	Q9T203	Bacillus_phage	58.3	5.2e-33
WP_009330380.1|4445669_4446203_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	3.7e-68
WP_057957669.1|4446202_4447912_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.0	5.5e-299
WP_048355562.1|4448099_4449344_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.2	5.2e-206
WP_048355561.1|4449333_4449963_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.3	5.1e-93
WP_048355560.1|4450003_4451320_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.7	2.2e-93
WP_048355559.1|4451345_4451795_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_048355558.1|4451810_4452161_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	59.5	3.3e-33
WP_048355557.1|4452090_4452465_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	66.4	4.3e-39
WP_048407268.1|4452457_4452841_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	69.3	1.3e-43
WP_048355555.1|4452837_4453206_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	57.4	7.7e-33
WP_048355554.1|4453218_4453827_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	55.1	6.3e-56
WP_048355553.1|4453886_4454225_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	62.5	1.4e-33
WP_048355552.1|4454227_4454410_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	66.7	1.3e-12
WP_057957668.1|4454422_4458310_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	65.1	0.0e+00
WP_057957670.1|4458309_4459146_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	73.6	7.0e-114
WP_048355551.1|4459158_4460868_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.2	3.2e-222
WP_057957667.1|4460901_4463466_+	peptidase G2	NA	D6R401	Bacillus_phage	60.4	2.8e-307
WP_096891819.1|4463478_4464819_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.0	3.6e-64
WP_048356295.1|4464833_4465136_+	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
WP_006637259.1|4465132_4465309_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	8.5e-06
WP_006637260.1|4465343_4465754_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.0	1.1e-24
WP_048356554.1|4465801_4466746_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.3	1.0e-60
WP_006637262.1|4466776_4467193_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_096892098.1|4467205_4468855_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	49.6	9.1e-57
WP_048356290.1|4469108_4469327_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_048356291.1|4469386_4470013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082634690.1|4470401_4470557_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.0	9.1e-12
4470279:4470338	attR	TAATTTACAATCGTAGTAAATTTAATCAAACCTTATGAATACTGAAGGGAAAGGGGATAT	NA	NA	NA	NA
WP_057957763.1|4470581_4471664_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	55.3	6.2e-46
>prophage 14
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	4474666	4483570	4659467	transposase	uncultured_Caudovirales_phage(37.5%)	12	NA	NA
WP_048355971.1|4474666_4476184_-|transposase	transposase	transposase	A0A1J0MFV1	Staphylococcus_phage	37.1	3.3e-05
WP_048355972.1|4476851_4477211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048355973.1|4477365_4477602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356347.1|4478149_4478788_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	47.7	8.7e-48
WP_053071291.1|4478784_4479447_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	1.1e-40
WP_048356340.1|4479626_4479980_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	47.8	5.1e-18
WP_048356341.1|4480155_4480359_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048356342.1|4480629_4481457_+	transcriptional regulator	NA	S6BFM4	Thermus_phage	29.9	9.2e-26
WP_048356343.1|4481356_4482139_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	46.2	4.0e-55
WP_048407231.1|4482412_4482748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356344.1|4482738_4482948_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	59.4	2.9e-13
WP_048356345.1|4483066_4483570_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	34.1	1.1e-18
>prophage 15
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	4599506	4638888	4659467	protease	Bacillus_phage(38.24%)	50	NA	NA
WP_048406682.1|4599506_4601600_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.0	1.2e-127
WP_048354923.1|4601848_4602883_+	membrane protein	NA	NA	NA	NA	NA
WP_048354928.1|4603134_4603794_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_048354922.1|4603795_4604236_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_048354921.1|4604228_4604960_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	46.4	5.2e-57
WP_046132306.1|4604979_4605471_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.5	1.3e-56
WP_048354920.1|4605852_4606701_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	59.0	9.1e-37
WP_096892112.1|4606714_4607206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892116.1|4607202_4607637_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	61.9	6.1e-37
WP_096891934.1|4607848_4608367_+	hypothetical protein	NA	K4NX74	Streptomyces_phage	53.1	1.2e-10
WP_048356544.1|4608356_4608686_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	32.2	2.1e-05
WP_096892118.1|4608725_4609109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892120.1|4609122_4609488_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.7	2.4e-18
WP_096892122.1|4609839_4610217_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	45.0	7.4e-23
WP_156416018.1|4610232_4610379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892124.1|4610392_4611160_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	51.9	4.2e-65
WP_048356590.1|4611156_4611657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082634673.1|4611656_4612445_+	phage antirepressor Ant	NA	A0A2P1JTZ2	Anoxybacillus_phage	55.1	1.4e-63
WP_057957675.1|4612463_4613813_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.2	8.3e-125
WP_057957674.1|4613834_4614815_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.8	3.5e-72
WP_082634672.1|4614844_4615093_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096892125.1|4615258_4616485_+	hypothetical protein	NA	A0A288WG12	Bacillus_phage	33.9	5.4e-46
WP_048356558.1|4616738_4617374_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_096892127.1|4617666_4618191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892129.1|4618438_4619218_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	51.9	1.6e-59
WP_048405737.1|4619214_4619799_+	hypothetical protein	NA	A0A0A8WEV5	Clostridium_phage	41.3	1.0e-34
WP_048405736.1|4619813_4620245_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.2	6.7e-12
WP_096892131.1|4620285_4621329_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	28.5	4.7e-19
WP_048354541.1|4621329_4621509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156416014.1|4621505_4621670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096892133.1|4621703_4624001_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.1	6.6e-122
WP_096892135.1|4624001_4625045_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.4	2.6e-81
WP_048405731.1|4625037_4625556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048356260.1|4625561_4625927_+	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	39.3	2.6e-12
WP_048356259.1|4625931_4626189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048405730.1|4626185_4626386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157769105.1|4626710_4627073_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.0	6.2e-27
WP_096892137.1|4627079_4629179_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.1	0.0e+00
WP_096892139.1|4629204_4629543_+	DUF1140 family protein	NA	Q94M85	Lactococcus_phage	41.8	5.8e-11
WP_096892141.1|4629581_4630553_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.1	5.8e-144
WP_096892143.1|4631333_4631915_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.5	7.6e-43
WP_096891916.1|4631914_4632142_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	76.4	5.1e-19
WP_096892146.1|4632142_4632973_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	66.8	7.2e-87
WP_096892148.1|4632942_4633533_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	60.4	3.9e-26
WP_096892150.1|4634730_4635291_+	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	46.4	5.1e-36
WP_096892151.1|4635287_4636643_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	71.7	7.8e-139
WP_048405720.1|4636624_4637014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096892153.1|4637089_4637518_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_096891910.1|4637510_4637999_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	42.3	1.2e-20
WP_048405718.1|4638087_4638888_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	55.0	7.5e-73
>prophage 16
NZ_CP023481	Bacillus glycinifermentans strain KBN06P03352 chromosome, complete genome	4659467	4644808	4654859	4659467	head,terminase,portal,protease,tail,capsid	Paenibacillus_phage(45.45%)	15	NA	NA
WP_053075443.1|4644808_4645198_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	35.2	9.4e-05
WP_080626793.1|4645514_4645814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407311.1|4646218_4646557_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.6e-13
WP_026699327.1|4646676_4647000_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	70.1	9.4e-35
WP_026699328.1|4646974_4648756_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	68.1	6.6e-247
WP_048356127.1|4648767_4650066_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.0	9.6e-86
WP_048356128.1|4650019_4650766_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	51.9	3.0e-60
WP_017474201.1|4650765_4651920_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_048356129.1|4651960_4652458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474199.1|4652460_4652700_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	40.5	1.5e-08
WP_048356130.1|4652704_4653040_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	53.3	4.6e-24
WP_048356131.1|4653036_4653459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474196.1|4653455_4653800_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	2.1e-16
WP_048356132.1|4653808_4654390_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_048356133.1|4654523_4654859_+	hypothetical protein	NA	H0USX2	Bacillus_phage	34.8	2.2e-10
