assembly_id	genome_id	genome_def	crispr_array_locus_merge	crispr_array_location_merge	crispr_locus_id	crispr_pred_method	array_in_prot	prot_within_array_20000	prot_in_genome	crispr_type_by_cas_prot	consensus_repeat	repeat_length	self-targeting_spacer_number	self-targeting_target_number	spacer_location	protospacer_location	repeat_type	spacer_locus_num	spacer_num	correct_crispr_type	genome_cas_prots	unknown_protein_around_crispr	L10	L10_domain	L9	L9_domain	L8	L8_domain	L7	L7_domain	L6	L6_domain	L5	L5_domain	L4	L4_domain	L3	L3_domain	L2	L2_domain	L1	L1_domain	R1	R1_domain	R2	R2_domain	R3	R3_domain	R4	R4_domain	R5	R5_domain	R6	R6_domain	R7	R7_domain	R8	R8_domain	R9	R9_domain	R10	R10_domain
GCF_002443015.1_ASM244301v1	NZ_CP022319	Bacillus altitudinis strain SGAir0031 chromosome, complete genome	1	755121-755343	1	PILER-CR	no		csa3,DEDDh,WYL,DinG,cas3	Orphan	AGGCGCCACAGGTGCGACAGGTGTAACAGGAGATACGGGTGCAACAGGGGCTACAG	56	0	0	NA	NA	NA	2	2	Orphan	csa3,DEDDh,WYL,DinG,cas3	NA,NA|142aa|down_8|NZ_CP022319.1_765155_765581_+	NA|381aa|up_9|NZ_CP022319.1_741118_742261_+	COG0513, SrmB, Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]	NA|335aa|up_8|NZ_CP022319.1_742297_743302_-	cd05288, PGDH, Prostaglandin dehydrogenases	NA|126aa|up_7|NZ_CP022319.1_743423_743801_-	pfam11486, DUF3212, Protein of unknown function (DUF3212)	NA|116aa|up_6|NZ_CP022319.1_744023_744371_+	pfam11181, YflT, Heat induced stress protein YflT	NA|219aa|up_5|NZ_CP022319.1_745305_745962_+	pfam13649, Methyltransf_25, Methyltransferase domain	NA|242aa|up_4|NZ_CP022319.1_746479_747205_+	cd00641, GTP_cyclohydro2, GTP cyclohydrolase II (RibA)	NA|268aa|up_3|NZ_CP022319.1_747237_748041_+	pfam03781, FGE-sulfatase, Sulfatase-modifying factor enzyme 1	NA|586aa|up_2|NZ_CP022319.1_748045_749803_+	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|451aa|up_1|NZ_CP022319.1_750158_751511_+	pfam13751, DDE_Tnp_1_6, Transposase DDE domain	NA|361aa|up_0|NZ_CP022319.1_751662_752745_+	TIGR00326, eubact_ribD, riboflavin biosynthesis protein RibD	NA|532aa|down_0|NZ_CP022319.1_756033_757629_+	COG3290, CitA, Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]	NA|233aa|down_1|NZ_CP022319.1_757632_758331_+	COG4565, CitB, Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]	NA|326aa|down_2|NZ_CP022319.1_758333_759311_+	COG3181, COG3181, Uncharacterized protein conserved in bacteria [Function unknown]	NA|433aa|down_3|NZ_CP022319.1_759502_760801_+	TIGR00784, Mg2+/citrate_complex_secondary_transporter, citrate transporter, CitMHS family	NA|544aa|down_4|NZ_CP022319.1_760982_762614_+	cd06242, M14-like, Peptidase M14-like domain; uncharacterized subgroup	NA|162aa|down_5|NZ_CP022319.1_762687_763173_-	pfam05870, PA_decarbox, Phenolic acid decarboxylase (PAD)	NA|186aa|down_6|NZ_CP022319.1_763286_763844_+	COG1695, COG1695, Predicted transcriptional regulators [Transcription]	NA|369aa|down_7|NZ_CP022319.1_763948_765055_+	pfam02898, NO_synthase, Nitric oxide synthase, oxygenase domain	NA|142aa|down_8|NZ_CP022319.1_765155_765581_+	NA	NA|91aa|down_9|NZ_CP022319.1_765595_765868_-	PRK14420, PRK14420, acylphosphatase; Provisional
