The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	27281	79601	4106189	tRNA,transposase	Synechococcus_phage(25.0%)	49	NA	NA
WP_010929577.1|27281_28232_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28313_28649_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28673_29108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247164.1|29140_30358_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30363_30861_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31068_32004_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32213_33005_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33047_34469_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003814398.1|35570_36761_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37010_37922_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37923_40062_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40058_40598_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40601_41330_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41316_42210_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247766.1|42280_42676_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42685_43216_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_023852754.1|43344_43644_-	DUF1974 domain-containing protein	NA	NA	NA	NA	NA
WP_010929589.1|45197_45746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45717_45954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46081_46975_+	membrane protein	NA	NA	NA	NA	NA
WP_010929590.1|48144_49392_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49388_50003_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50138_51089_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51131_52388_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53619_54354_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54359_54950_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54974_55664_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55660_56422_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56501_57401_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57494_58445_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59245_60472_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010929596.1|60471_60891_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61074_62016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62439_63414_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63470_64052_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64064_64367_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64485_65544_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65578_66850_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67479_68661_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69082_70033_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816713.1|70126_70441_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_010929604.1|71633_73541_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
WP_010929605.1|73702_74323_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003807804.1|74354_74936_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
WP_003807805.1|75024_75276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929606.1|75277_76120_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_010929607.1|76225_77635_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005012067.1|77631_78582_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166334.1|78656_79601_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	107424	175245	4106189	tRNA,transposase	Bacillus_phage(22.22%)	56	NA	NA
WP_010929626.1|107424_108375_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|109274_110468_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|110549_111179_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|111240_111924_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|111933_113616_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|113903_114251_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|114341_114659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|114941_115958_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|116033_116834_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|116830_117706_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010929633.1|117716_119009_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|119051_120092_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|120197_121019_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|121119_122070_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|122167_123073_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|123069_123903_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|124739_125750_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|125746_126136_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|127029_128283_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|128373_130074_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|130500_131148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853393.1|131146_132586_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_023853394.1|132696_132981_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010929512.1|133008_133887_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|135153_136104_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815155.1|136522_138031_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_019247146.1|138777_142740_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929644.1|142792_143575_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929645.1|143662_144886_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929646.1|144869_145802_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_003817676.1|145807_146620_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010929647.1|147932_148904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815135.1|149022_149805_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929648.1|150571_151552_-	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_010929649.1|151548_152277_-	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_003815126.1|152301_152733_-	VOC family protein	NA	NA	NA	NA	NA
WP_010929650.1|152834_153710_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853237.1|153760_154960_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	42.6	3.1e-91
WP_010929652.1|155063_155525_-	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_010929653.1|155629_157027_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_010929654.1|157023_157701_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.5e-29
WP_010929655.1|157756_159067_-	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	25.5	6.2e-16
WP_003815113.1|159078_159777_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.1	8.6e-33
WP_003815111.1|159940_160717_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_010929656.1|160882_161905_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_023853232.1|162133_162769_+	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_023995348.1|162774_164328_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	28.7	1.0e-33
WP_005015810.1|164886_165837_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|167280_168183_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|168160_168790_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|169072_170503_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|170536_171166_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|171214_172822_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|172846_173530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|173611_174088_-	bacterioferritin	NA	NA	NA	NA	NA
WP_010929591.1|174294_175245_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	178627	236262	4106189	tRNA,transposase,protease	Klosneuvirus(14.29%)	48	NA	NA
WP_010929666.1|178627_180706_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|180955_181228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|181329_182415_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|182418_184323_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|184319_187994_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|188054_188618_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|188625_189048_-	glyoxalase	NA	NA	NA	NA	NA
WP_010929671.1|189075_189495_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_077274090.1|189523_189970_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	29.4	1.2e-08
WP_003808391.1|190096_190594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|190748_193019_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_019249381.1|193094_194300_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929591.1|194397_195348_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|195450_196086_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_019248671.1|196082_196976_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|197370_198471_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|198552_198927_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|198986_201851_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|201995_202736_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|202805_204017_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929680.1|204045_205014_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931070.1|205627_206578_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|206734_207058_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|207162_208203_-	cyclase	NA	NA	NA	NA	NA
WP_010929697.1|208208_208988_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|209033_209330_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|209355_209631_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|209687_210332_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|210331_211018_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_033446325.1|211216_211999_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|212049_212775_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|212806_214156_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|214267_215200_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033455792.1|215657_218453_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_023994893.1|219046_221890_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|222060_222780_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|222818_223367_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929687.1|223521_224421_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|224445_225396_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818947.1|225613_226309_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247308.1|226325_227738_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929684.1|227850_229281_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929683.1|229322_231236_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929682.1|231554_232121_+	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929681.1|232211_233213_+	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_005012067.1|233327_234278_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|234364_235315_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|235311_236262_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	250675	303008	4106189	tRNA,transposase,protease	Bacillus_phage(25.0%)	46	NA	NA
WP_003814337.1|250675_251617_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_010929705.1|251613_253503_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814332.1|253589_254228_+	membrane protein	NA	NA	NA	NA	NA
WP_019247543.1|254370_255756_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_010929706.1|255686_256223_-|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_010929707.1|256374_257766_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929708.1|257782_258763_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003814324.1|258898_259882_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929709.1|259946_260846_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814321.1|260952_262707_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929710.1|262714_263839_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929711.1|263852_264833_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|265563_266514_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929712.1|267073_267619_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852659.1|267744_269322_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004567834.1|269337_270492_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003817696.1|270505_270631_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_010929714.1|270627_272379_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_010929715.1|272375_274055_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929716.1|274117_274666_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929717.1|275808_276087_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|277130_278081_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929718.1|278357_278519_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_003815821.1|279185_279635_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_003815819.1|279644_280256_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_010929720.1|280414_281263_-	cytochrome c1	NA	NA	NA	NA	NA
WP_003815816.1|281288_282671_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_003815815.1|282735_283377_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_010929721.1|283516_283975_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_010927226.1|283999_284776_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_014906092.1|284829_285966_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	31.2	1.2e-07
WP_005015810.1|285962_286913_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003807705.1|287010_287637_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_003807706.1|287659_288586_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_003819100.1|288594_290181_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929723.1|290177_291182_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
WP_003807710.1|291381_292242_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929724.1|292273_293275_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_003819104.1|293345_294155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003819105.1|294232_296092_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_010929725.1|296220_297423_-	MFS transporter	NA	NA	NA	NA	NA
WP_004566082.1|297536_298418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004566083.1|299920_300481_-	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
WP_005013747.1|300540_301491_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_111735998.1|301682_301970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930048.1|302057_303008_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	390843	448352	4106189	transposase	Orpheovirus(14.29%)	50	NA	NA
WP_005012067.1|390843_391794_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|391930_392848_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|392844_393093_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003815840.1|393089_394295_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|394367_395363_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486046.1|395385_396606_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|396602_397247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248476.1|398977_399787_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486048.1|400091_401045_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|401143_402127_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|402053_402755_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|402803_403574_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|403570_404749_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|404916_406623_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_014486053.1|406619_407516_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|407556_409146_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003807867.1|409195_410188_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|410256_410856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|411316_412297_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|412372_413323_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122777.1|413411_414326_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010929782.1|414322_414982_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003814709.1|415071_415995_+	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929783.1|416000_416456_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_010929784.1|416452_417556_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_157734664.1|417511_417784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010927086.1|417743_419363_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003814720.1|419359_420418_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_033446199.1|420547_421042_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022997984.1|421134_422112_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929785.1|422307_423513_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_010929786.1|423509_425021_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003814726.1|425036_426350_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_003814728.1|426540_426720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814730.1|427129_427864_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_010929577.1|430308_431259_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247421.1|431390_431789_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_003814701.1|432199_432670_-	universal stress protein	NA	NA	NA	NA	NA
WP_003820700.1|432758_433103_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010929788.1|433202_434603_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010929789.1|436391_436910_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_003814694.1|437020_437776_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_003814691.1|437971_439204_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929791.1|439196_439982_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814685.1|440048_441020_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814681.1|441030_442008_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247419.1|442133_443306_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010929793.1|443332_444361_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814674.1|444426_445620_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|447401_448352_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	589354	650544	4106189	transposase,protease	uncultured_Mediterranean_phage(40.0%)	55	NA	NA
WP_005013747.1|589354_590305_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446133.1|590780_591671_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931496.1|591667_592489_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_019247235.1|592688_593180_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_019247236.1|593198_594272_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023853086.1|594318_595422_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003808577.1|595497_596118_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003808574.1|596138_596648_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808570.1|596702_596954_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_077108607.1|596950_598150_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808567.1|598157_598544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931493.1|598540_601060_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003808563.1|601488_601827_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003808562.1|601823_602330_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010931492.1|602391_603192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931491.1|603302_604244_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931490.1|604337_605873_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931489.1|607552_609403_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_003808549.1|609406_610240_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931488.1|610239_611181_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931487.1|611432_612404_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931486.1|612545_614834_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003808542.1|615140_616049_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931485.1|616103_617069_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_062810229.1|617143_618805_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931483.1|618876_619587_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|619735_620686_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814152.1|621384_621768_+	membrane protein	NA	NA	NA	NA	NA
WP_010927005.1|621825_622428_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003820995.1|622445_622847_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010931482.1|622962_623874_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931481.1|623870_624452_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003814165.1|625246_625981_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010931480.1|626021_627071_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003814172.1|627218_627797_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931479.1|628183_629161_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_010931478.1|629254_633649_-	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_003814178.1|633849_634698_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931477.1|634856_635669_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015810.1|635724_636675_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|636773_637574_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|637635_638019_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_033446148.1|638030_639383_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
WP_003814188.1|639670_640000_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010931455.1|640002_640752_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|640934_641855_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|641901_642114_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|642136_642559_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_010931458.1|642575_643676_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|643772_645290_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|645365_646205_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_033446149.1|646226_647099_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|647189_648284_-	porin	NA	NA	NA	NA	NA
WP_076879617.1|648577_649528_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166340.1|649602_650544_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	655868	702058	4106189	tRNA,tail,terminase,transposase	uncultured_Caudovirales_phage(18.18%)	49	NA	NA
WP_023995141.1|655868_656894_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814221.1|656934_657174_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931464.1|657243_658833_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_010931465.1|658832_659381_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003814226.1|659461_660034_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010927008.1|660052_660964_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814230.1|661037_662006_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010931466.1|662128_663202_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_010931467.1|663206_665027_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_033446132.1|666141_666477_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003819076.1|666610_667261_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010931468.1|667282_668701_-	amidase	NA	NA	NA	NA	NA
WP_019248554.1|668770_669526_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247734.1|669494_670253_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931471.1|670263_671145_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931472.1|671161_671869_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931473.1|671871_672630_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931474.1|672839_674582_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010925795.1|674574_675099_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931475.1|675138_675933_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248926.1|676100_677174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|677272_678223_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247378.1|678474_678681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931451.1|678752_679364_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|679918_680170_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_161633094.1|680162_680852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|681108_682059_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247942.1|682698_683184_+|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_010931447.1|683170_684448_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_010931446.1|684450_685869_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931445.1|685897_686953_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931444.1|686958_687201_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931443.1|687323_687926_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_005012808.1|688354_689305_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931442.1|689979_690231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|690293_690776_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_162096760.1|690789_690978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931439.1|690977_691373_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931438.1|691369_691768_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931437.1|691764_692187_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931436.1|692194_692695_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931435.1|692949_693468_+	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_003813412.1|693477_693807_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931434.1|693824_694115_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_010931433.1|694140_696753_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931432.1|696762_697122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931431.1|697189_697723_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931430.1|697719_698109_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931429.1|698101_702058_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
>prophage 8
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	708224	778298	4106189	tRNA,transposase	Planktothrix_phage(40.0%)	57	NA	NA
WP_003814636.1|708224_709955_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_010931419.1|710007_710436_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814641.1|710438_711119_+	protein TolQ	NA	NA	NA	NA	NA
WP_003814643.1|711118_711577_+	protein TolR	NA	NA	NA	NA	NA
WP_010931418.1|711613_712588_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_010931417.1|712604_713921_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003814650.1|713952_714450_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003814652.1|714536_715226_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_010931416.1|715225_716275_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814657.1|716271_717066_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_019247923.1|717234_717585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247922.1|717560_718118_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012808.1|719247_720198_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929184.1|722335_723565_+	spore maturation protein	NA	NA	NA	NA	NA
WP_003814419.1|723567_725010_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010931414.1|725114_726260_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_010931413.1|726291_727089_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931412.1|727113_728673_-	chaperone SurA	NA	NA	NA	NA	NA
WP_010931411.1|728669_731042_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931410.1|731151_732255_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010931409.1|732254_732947_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003814436.1|733090_733792_+	membrane protein	NA	NA	NA	NA	NA
WP_003814437.1|733776_734154_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005012067.1|734885_735836_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|735995_736868_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|737208_737427_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_019247242.1|737466_738846_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010927038.1|740323_741976_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|741979_742864_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|742863_743805_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929979.1|743883_745503_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929980.1|745669_746485_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|746552_747122_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|747122_748073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|748727_749825_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|749858_751124_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929982.1|752474_753065_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929983.1|753080_755525_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003814467.1|755644_756616_-	FecR family protein	NA	NA	NA	NA	NA
WP_023852739.1|756747_757272_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005012067.1|757231_758182_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_094145978.1|758403_760602_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_020699729.1|760670_761078_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|761200_762151_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003807452.1|762266_762710_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010925762.1|762772_763567_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003807457.1|763732_764869_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
WP_003807459.1|764939_766073_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003807460.1|766222_766483_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003807462.1|766516_766828_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_010929987.1|767252_768401_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_010929988.1|768515_769481_+	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_010929989.1|769749_770616_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929990.1|770746_772795_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929991.1|772812_774810_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929992.1|774844_776182_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023853308.1|776444_778298_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	860765	1000551	4106189	transposase	Bacillus_phage(11.76%)	116	NA	NA
WP_005013747.1|860765_861716_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930032.1|861936_862605_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930031.1|862728_863835_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930030.1|863847_866961_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
WP_010930029.1|866957_868451_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010926969.1|868465_869137_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003813974.1|869180_869675_-	azurin	NA	NA	NA	NA	NA
WP_010930027.1|869815_870463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023853163.1|870566_872615_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930025.1|872611_874624_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930024.1|874649_875984_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003813981.1|876092_877085_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|877151_879236_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930023.1|879260_880232_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930022.1|880360_881392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930021.1|881395_882547_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_076879542.1|882717_883641_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_003813987.1|883718_884543_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023994644.1|884739_885756_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813988.1|885952_886936_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930019.1|888534_889923_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003813991.1|889953_890943_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813992.1|891053_892286_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003813993.1|892567_893368_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930018.1|893390_895622_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_010930017.1|896409_896856_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003813996.1|896877_897624_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003813997.1|897767_898745_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930016.1|899378_899990_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813999.1|899983_901201_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_005013747.1|901341_902292_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|902390_903341_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814000.1|903337_904057_-	lipoprotein	NA	NA	NA	NA	NA
WP_003821234.1|904177_906337_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814002.1|906427_906697_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|906785_906992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814003.1|906990_907518_+	lipoprotein	NA	NA	NA	NA	NA
WP_003814004.1|907536_908316_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930015.1|908483_909500_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814006.1|909572_910064_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|910074_911790_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012067.1|912953_913904_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930051.1|913900_915733_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_010930052.1|916131_916791_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_010930054.1|917318_917999_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_010930055.1|918280_918997_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930056.1|919011_920313_-	phospholipase	NA	NA	NA	NA	NA
WP_029444137.1|922457_925346_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930057.1|925569_926922_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004568140.1|926950_927472_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003819989.1|927468_928923_+	carboxylase	NA	NA	NA	NA	NA
WP_023852826.1|928957_929206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247557.1|929311_930187_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010930060.1|930212_931268_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930061.1|931280_932072_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930062.1|932104_933475_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005012067.1|934651_935602_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930064.1|935654_935876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810832.1|936035_936248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|936367_937486_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810837.1|937582_937798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810839.1|937991_938243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930066.1|938355_939306_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810840.1|939302_939686_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_023852913.1|939740_941555_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_010930068.1|941704_942532_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_010930069.1|942577_943558_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003810850.1|943554_943767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810851.1|943763_944945_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_019248496.1|945108_945843_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
WP_010930071.1|945844_948457_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003810859.1|948592_950506_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930072.1|951121_951532_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810865.1|951629_952715_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005012067.1|952813_953764_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930088.1|953760_954735_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003821497.1|954859_955771_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_004566317.1|956047_956440_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_005012808.1|956569_957520_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930090.1|957549_957732_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
WP_010930091.1|958504_959686_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930092.1|959901_960579_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010930093.1|960575_961301_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_010930094.1|961426_962008_-	OmpA family protein	NA	NA	NA	NA	NA
WP_010930095.1|962378_965060_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
WP_023852687.1|965062_966193_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
WP_010930097.1|966185_967271_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_010930098.1|967357_968257_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010930099.1|968253_969582_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010930100.1|969596_970268_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_010930101.1|970455_972171_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010930102.1|972172_972532_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_010930103.1|972723_973038_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_010930104.1|973080_974301_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_010930105.1|974297_975239_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
WP_003821513.1|975235_976225_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
WP_033446303.1|976259_976844_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|976942_977893_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486062.1|977973_978885_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
WP_010930108.1|978945_980091_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_003821521.1|980110_981025_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
WP_010930110.1|981096_981846_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_010930111.1|981845_982775_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_003821527.1|983018_984845_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003813333.1|984927_985569_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003821528.1|985758_986793_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930112.1|988628_989693_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
WP_010930113.1|990490_991399_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_023852693.1|992886_994161_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_023852686.1|994314_994695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014905652.1|994702_995575_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003813315.1|995880_996261_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003813314.1|996471_997197_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005012067.1|997292_998243_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930118.1|998347_999397_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_010929632.1|999534_1000551_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1024355	1082437	4106189	tRNA,transposase	uncultured_Mediterranean_phage(37.5%)	51	NA	NA
WP_010929584.1|1024355_1025306_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930130.1|1025404_1026145_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010930131.1|1026339_1028376_+	transketolase	NA	NA	NA	NA	NA
WP_010930132.1|1028393_1029404_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930133.1|1029521_1030715_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930134.1|1030744_1031518_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930135.1|1031514_1032705_-	acetate kinase	NA	NA	NA	NA	NA
WP_003809454.1|1032730_1033669_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930136.1|1033665_1036014_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_129111609.1|1036168_1036831_-	glutathione transferase	NA	NA	NA	NA	NA
WP_023994624.1|1038138_1038291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930138.1|1038322_1038871_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_003819814.1|1038889_1039375_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930139.1|1039552_1040491_+	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003809467.1|1040493_1040811_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247197.1|1040856_1041801_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010930141.1|1043481_1044132_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003809479.1|1044185_1044521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|1044517_1045378_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003819817.1|1045394_1045676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003809486.1|1045749_1046013_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005012067.1|1046256_1047207_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811933.1|1047505_1048243_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_010930143.1|1048678_1049002_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811929.1|1049036_1049597_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003811927.1|1049715_1050591_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003817154.1|1050603_1051551_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_019247393.1|1051652_1051946_+	response regulator	NA	NA	NA	NA	NA
WP_010930144.1|1051972_1054030_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003811919.1|1054044_1054545_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930145.1|1054618_1056325_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_010930146.1|1057188_1058241_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003811911.1|1058293_1058683_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_003817162.1|1058691_1059324_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010931363.1|1059423_1060440_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003819773.1|1061270_1062278_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014486064.1|1062274_1063918_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930149.1|1063914_1064802_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003809396.1|1064942_1065416_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930151.1|1065405_1066428_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_015041211.1|1066424_1067852_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010931363.1|1068789_1069806_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|1070138_1071074_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|1071123_1073004_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|1073070_1073415_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|1073559_1074696_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|1074692_1075766_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|1075923_1077360_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1077450_1078092_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023853536.1|1078427_1079444_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|1081486_1082437_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1086483	1158501	4106189	tRNA,transposase,holin	Planktothrix_phage(18.18%)	55	NA	NA
WP_003819794.1|1086483_1086897_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1086898_1087258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930163.1|1088927_1089758_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1089792_1090947_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1090989_1091862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486065.1|1091978_1094267_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003809441.1|1095473_1095938_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1095964_1096915_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930167.1|1097282_1098059_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_003809638.1|1098103_1098961_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930169.1|1098982_1099999_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014486066.1|1100133_1101174_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930171.1|1101368_1103450_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_010930172.1|1103685_1105179_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003809629.1|1105409_1106204_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003819875.1|1106424_1107783_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010930173.1|1107779_1108622_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_010930174.1|1108640_1110527_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_162096758.1|1110468_1110720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930175.1|1110764_1111397_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003809618.1|1111415_1112018_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|1112169_1113120_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1113700_1114408_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1114766_1115753_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1115892_1116906_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1116902_1117853_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812703.1|1117965_1118424_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1118460_1119774_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_010930180.1|1119791_1120163_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_019248549.1|1120159_1121623_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930182.1|1121763_1122492_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930183.1|1122473_1125323_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010929591.1|1125535_1126486_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930184.1|1126653_1127478_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010930185.1|1127477_1128356_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930186.1|1129260_1130376_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699602.1|1130404_1131199_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930188.1|1131195_1133061_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_003812436.1|1133139_1133772_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930189.1|1133768_1134071_-	membrane protein	NA	NA	NA	NA	NA
WP_010930190.1|1134113_1135634_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010926447.1|1135640_1136396_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010926448.1|1136425_1137530_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010930191.1|1137632_1139333_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010930192.1|1139314_1140292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247537.1|1140301_1141582_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003812422.1|1141574_1142270_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_010928340.1|1142303_1143131_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_010930194.1|1143412_1146643_+	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010930196.1|1147376_1151303_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_023853221.1|1153202_1154999_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248398.1|1154998_1155967_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816844.1|1156036_1156882_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003812405.1|1156949_1157504_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_010930198.1|1157550_1158501_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1216786	1298695	4106189	tRNA,transposase	Bacillus_virus(25.0%)	58	NA	NA
WP_076879566.1|1216786_1217737_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|1217823_1218774_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931069.1|1219979_1221008_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010931068.1|1221087_1222386_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003816847.1|1222382_1222964_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010931067.1|1223276_1227323_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
WP_010931066.1|1227563_1235225_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
WP_005012067.1|1235221_1236172_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931065.1|1237311_1237785_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931064.1|1237923_1238544_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931063.1|1238679_1239480_+	aldolase	NA	NA	NA	NA	NA
WP_003810897.1|1239534_1240626_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931062.1|1240647_1241091_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_010931061.1|1241119_1241752_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_003810909.1|1241862_1242279_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931060.1|1242271_1242964_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_010931059.1|1243070_1243445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931058.1|1243521_1244331_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931057.1|1244426_1245371_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_003816577.1|1245409_1246381_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003810921.1|1246471_1246909_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443733.1|1246967_1247849_-	NRDE family protein	NA	NA	NA	NA	NA
WP_010931054.1|1248852_1249713_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931053.1|1249745_1251128_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.4	7.9e-30
WP_010931052.1|1251124_1252144_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247407.1|1252516_1253011_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931051.1|1253018_1253759_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931050.1|1253839_1255444_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_010931049.1|1255483_1256272_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	2.0e-22
WP_023995127.1|1256397_1258563_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-14
WP_010931047.1|1259443_1260256_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004568502.1|1260268_1260577_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_010931046.1|1260694_1262425_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931045.1|1262426_1263629_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931044.1|1263701_1264370_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003810957.1|1264491_1264959_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019247521.1|1265094_1266477_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_014486086.1|1266473_1267598_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_010931042.1|1267594_1270231_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931070.1|1270646_1271597_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|1275343_1275955_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|1276177_1277638_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|1277734_1279327_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|1279680_1279938_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|1279939_1281280_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|1281375_1282065_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|1282077_1283508_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|1285232_1286054_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|1286064_1287636_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|1287664_1288642_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|1288668_1289472_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|1289468_1290263_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|1290270_1291506_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_019247978.1|1291519_1291933_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1292682_1293633_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931031.1|1294254_1295982_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|1296093_1297452_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|1297744_1298695_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1418087	1472313	4106189	tRNA,transposase	Salmonella_phage(22.22%)	44	NA	NA
WP_005013747.1|1418087_1419038_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814065.1|1419204_1419558_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|1419570_1419933_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|1419974_1420400_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|1420602_1421859_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|1422057_1423038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|1423187_1424429_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1424527_1425478_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|1425486_1426182_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|1429003_1429603_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|1429613_1431779_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|1431802_1433587_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|1433586_1433676_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|1434370_1434643_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|1434642_1436709_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|1436705_1437656_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1437753_1438704_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|1438819_1439152_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|1439148_1439835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930948.1|1439821_1440781_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010930947.1|1440813_1443183_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|1443182_1443815_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|1443916_1445257_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|1445303_1446659_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_005014990.1|1446949_1447186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|1447373_1447691_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|1447963_1448479_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814021.1|1448749_1449505_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|1449843_1450050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|1450057_1450717_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|1451011_1453216_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|1453326_1454550_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|1454672_1455647_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1455714_1456908_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|1456922_1457723_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|1457719_1459576_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|1459572_1460178_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1460196_1461582_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814012.1|1462307_1463534_+	transporter	NA	NA	NA	NA	NA
WP_003814011.1|1463622_1464405_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814010.1|1465479_1466253_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_076879548.1|1469286_1470237_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930389.1|1470268_1471366_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.5e-20
WP_005013747.1|1471362_1472313_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1618193	1673784	4106189	transposase	Brazilian_cedratvirus(25.0%)	47	NA	NA
WP_005013747.1|1618193_1619144_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|1619202_1619976_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|1619968_1621525_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1621521_1622472_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1623798_1624401_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1624640_1625342_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1625335_1626118_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1626302_1627253_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1627351_1628089_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1628278_1629037_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1629083_1630073_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1630250_1631219_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1632758_1633727_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1633735_1634677_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1635150_1636161_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1636151_1637666_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1637662_1639009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930475.1|1639011_1640046_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1640095_1641721_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1642273_1643224_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1643328_1644276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1644329_1646144_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1646136_1646811_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1646940_1650015_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1650028_1650328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1650642_1651266_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010930493.1|1651509_1652379_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1652356_1653301_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1653386_1654313_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1654425_1655205_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1655195_1656392_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1656422_1657373_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1657594_1658284_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1658348_1659104_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1659155_1660148_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1660157_1661111_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1661226_1662189_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1663590_1664019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1664015_1664966_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930503.1|1665259_1665982_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1666420_1667608_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930505.1|1667611_1667962_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1669711_1670683_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1670696_1671410_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1671414_1672332_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1672438_1672735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1672833_1673784_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1831548	1890816	4106189	tRNA,transposase,protease	Klosneuvirus(40.0%)	51	NA	NA
WP_005013747.1|1831548_1832499_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|1832623_1833433_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010929577.1|1833632_1834583_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930574.1|1835856_1837074_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_003818670.1|1838129_1839032_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930576.1|1839108_1839981_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003818672.1|1840111_1840480_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_010930577.1|1840537_1841584_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_010930578.1|1841779_1843036_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003810623.1|1843040_1844378_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003818676.1|1844527_1845484_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247555.1|1845586_1846519_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_019247554.1|1846634_1846955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247553.1|1846947_1847307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930581.1|1847354_1848929_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810637.1|1848981_1849926_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930582.1|1849943_1850774_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930583.1|1850766_1852401_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.2e-18
WP_010930584.1|1852397_1853753_+	amidase	NA	NA	NA	NA	NA
WP_010930585.1|1854659_1856237_+	lipoprotein	NA	NA	NA	NA	NA
WP_010930586.1|1856240_1857515_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_010930587.1|1857612_1857987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930588.1|1859702_1860836_+	general secretion pathway protein	NA	NA	NA	NA	NA
WP_003810661.1|1860873_1861479_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010930589.1|1861475_1862294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930590.1|1862365_1864990_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
WP_004568544.1|1864976_1865231_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930591.1|1865297_1865879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926757.1|1866182_1866443_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014905757.1|1866608_1867232_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003816734.1|1867231_1868005_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010930593.1|1868001_1869210_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010930594.1|1869235_1869709_-	RidA family protein	NA	NA	NA	NA	NA
WP_010930048.1|1869782_1870733_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879566.1|1870831_1871782_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930796.1|1871880_1873230_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_023852900.1|1873995_1874751_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930794.1|1874843_1877726_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_003810689.1|1878048_1878474_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_004568542.1|1878501_1879650_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810693.1|1879646_1880153_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033446257.1|1880168_1881455_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_033446258.1|1881504_1882800_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930791.1|1882801_1883440_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023852925.1|1883445_1884603_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_003810703.1|1884629_1885985_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010930790.1|1885988_1887059_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810707.1|1887197_1887434_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930789.1|1887521_1888628_+	GTPase HflX	NA	NA	NA	NA	NA
WP_010930788.1|1888593_1889898_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930787.1|1889916_1890816_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 16
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	1901056	1945377	4106189	transposase	Staphylococcus_phage(25.0%)	43	NA	NA
WP_005013747.1|1901056_1902007_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1902105_1903056_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930782.1|1903255_1904341_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003810400.1|1904356_1905118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930781.1|1905114_1906038_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
WP_019248115.1|1906136_1906661_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930779.1|1906669_1907413_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010930778.1|1907508_1907748_-	membrane protein	NA	NA	NA	NA	NA
WP_010930777.1|1907761_1907914_-	lipoprotein	NA	NA	NA	NA	NA
WP_010930776.1|1907999_1909490_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_010930775.1|1909581_1910520_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_003818560.1|1910516_1910693_-	cytochrome oxidase	NA	NA	NA	NA	NA
WP_003810383.1|1910695_1911358_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003810379.1|1912979_1913123_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_010930774.1|1913119_1914094_-	membrane protein	NA	NA	NA	NA	NA
WP_005012067.1|1914260_1915211_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930773.1|1915207_1916482_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_010930771.1|1917774_1918428_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930770.1|1918424_1919861_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930769.1|1919848_1920208_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_162268681.1|1921022_1921163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1921180_1922131_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930768.1|1923175_1925041_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930767.1|1925298_1926819_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003816959.1|1926906_1927557_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_010930766.1|1928505_1929801_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_010930765.1|1929822_1930707_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930764.1|1930805_1931681_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003816964.1|1931670_1932027_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930763.1|1932157_1933132_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|1933261_1933441_-	DUF3008 family protein	NA	NA	NA	NA	NA
WP_029443822.1|1933538_1934063_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_010930761.1|1934073_1934910_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816971.1|1935022_1935394_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930760.1|1935390_1935942_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816975.1|1935957_1937649_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_003816977.1|1937697_1938378_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014905663.1|1938625_1939090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|1939259_1940189_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_019247659.1|1940201_1940849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023997035.1|1940922_1942740_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_005012067.1|1942823_1943774_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|1944426_1945377_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2148887	2219644	4106189	tRNA,transposase,protease	Lake_Baikal_phage(10.53%)	60	NA	NA
WP_010930556.1|2148887_2150192_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_003812508.1|2150296_2150950_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930555.1|2150952_2152263_-	trigger factor	NA	NA	NA	NA	NA
WP_076879561.1|2152441_2153020_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930553.1|2153131_2153332_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_003812519.1|2153677_2154244_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930551.1|2154327_2154531_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812524.1|2154837_2155158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812526.1|2155199_2155481_-	membrane protein	NA	NA	NA	NA	NA
WP_010930550.1|2155555_2156812_-	autotransporter Phg	NA	NA	NA	NA	NA
WP_010930549.1|2157194_2157524_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003812536.1|2159094_2159916_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|2159915_2161055_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_019247938.1|2161061_2161958_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_033446179.1|2161972_2163880_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010926400.1|2164239_2166852_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003812546.1|2166904_2169205_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_003812548.1|2169201_2170410_-	aminotransferase	NA	NA	NA	NA	NA
WP_010930545.1|2170671_2171046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2171042_2171993_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879626.1|2172091_2174086_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930543.1|2174145_2175111_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2175100_2177962_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2177964_2178471_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2178575_2179784_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2179785_2180724_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2180885_2181359_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2181355_2182306_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566334.1|2182416_2182857_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|2182985_2184215_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566336.1|2184253_2185075_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|2185128_2186280_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930535.1|2186371_2186860_-	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_019247811.1|2189410_2191960_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_010930533.1|2192030_2194604_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_003813568.1|2194869_2195070_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003813570.1|2195101_2195263_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813572.1|2195320_2195659_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|2195807_2196758_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247882.1|2197531_2198200_+	arylesterase	NA	NA	NA	NA	NA
WP_010930531.1|2198181_2200137_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004568486.1|2200379_2201129_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_003816518.1|2201141_2202005_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_003816520.1|2202008_2203424_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_010930530.1|2203557_2204286_-	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003811035.1|2204424_2204625_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003816523.1|2204800_2205199_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003816525.1|2205222_2206623_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_010930529.1|2206741_2207494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003816527.1|2207782_2208460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248494.1|2208486_2209266_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_019247478.1|2210163_2210943_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_010930526.1|2210927_2211686_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_023852762.1|2211823_2212459_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010929632.1|2212726_2213743_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930524.1|2213840_2214881_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_003811011.1|2215015_2216308_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003811007.1|2217667_2218051_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_010930523.1|2218068_2218656_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_005012067.1|2218693_2219644_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2576461	2642961	4106189	transposase	uncultured_Caudovirales_phage(40.0%)	56	NA	NA
WP_005012067.1|2576461_2577412_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2577781_2578354_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2578356_2579367_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2579359_2579860_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2579870_2580212_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010930334.1|2580280_2581015_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2581031_2581301_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2581323_2582112_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010929632.1|2582158_2583175_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2583391_2584834_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2585012_2586632_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2586752_2588573_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2588651_2590184_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_010930329.1|2590217_2591864_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2591933_2592956_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2592973_2594107_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2594109_2594799_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2594798_2595584_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2595627_2596392_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2596430_2597852_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_010930324.1|2597917_2598622_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2598669_2599089_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2599101_2599509_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2599692_2600403_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2600529_2600820_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2600837_2601320_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2605825_2606980_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_010931363.1|2607285_2608302_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2608548_2609337_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2609403_2610084_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2610080_2610851_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|2610949_2611900_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|2611955_2612873_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|2612883_2614062_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|2614081_2615077_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|2616665_2617274_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|2617261_2618302_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|2618319_2619282_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|2619278_2620472_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|2620468_2621266_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|2621291_2622278_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|2622296_2624336_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
WP_010930315.1|2624537_2625218_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|2625231_2626143_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|2626139_2626718_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|2626856_2627762_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930312.1|2627769_2631189_+	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930311.1|2631176_2633777_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|2634732_2635365_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|2635758_2636517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811370.1|2636513_2637716_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|2637903_2638854_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930310.1|2639761_2640907_+	DUF3182 family protein	NA	NA	NA	NA	NA
WP_019247449.1|2640893_2641649_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003811361.1|2641765_2641945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|2642010_2642961_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2671075	2708486	4106189	transposase	Planktothrix_phage(33.33%)	39	NA	NA
WP_005012067.1|2671075_2672026_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2672124_2673075_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811316.1|2673167_2673707_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_023852799.1|2673813_2674158_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_010930298.1|2674215_2675664_-	CoA transferase	NA	NA	NA	NA	NA
WP_003811313.1|2675851_2676187_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930297.1|2677814_2678993_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811310.1|2679075_2679576_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930296.1|2679685_2680387_+	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_010930295.1|2680398_2680863_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023852802.1|2680877_2681153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811306.1|2681149_2681926_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_010930294.1|2681954_2682782_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_010930293.1|2682907_2683378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811301.1|2683504_2684398_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930292.1|2684445_2685627_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811298.1|2685639_2686455_-	exported protein	NA	NA	NA	NA	NA
WP_010930291.1|2686588_2687116_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811295.1|2687112_2687610_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003811293.1|2687757_2688135_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_010929584.1|2688356_2689307_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811244.1|2689404_2690016_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930290.1|2690250_2691378_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930289.1|2691488_2692577_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_003811259.1|2692629_2693481_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_003811262.1|2693500_2694382_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_010930288.1|2694558_2695872_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811267.1|2696082_2696916_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930287.1|2696912_2697494_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_005015810.1|2697847_2698798_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930286.1|2698813_2699929_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811272.1|2700031_2700958_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930285.1|2700957_2702196_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811277.1|2702192_2702960_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_010930284.1|2702960_2703662_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
WP_019247793.1|2703743_2704190_-	glutamate racemase	NA	NA	NA	NA	NA
WP_010930283.1|2705079_2705718_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012808.1|2706486_2707437_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|2707535_2708486_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2813945	2886526	4106189	transposase	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	59	NA	NA
WP_010929591.1|2813945_2814896_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931075.1|2816057_2816564_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_003813293.1|2816560_2817325_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010931076.1|2817340_2817625_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_003813298.1|2817689_2818679_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_010931077.1|2818850_2819780_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_003813302.1|2819751_2820438_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003813303.1|2820471_2821017_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
WP_003813306.1|2821061_2822327_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003813309.1|2822323_2823226_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_019247679.1|2824407_2825352_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931079.1|2825446_2826964_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931080.1|2827005_2828634_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003811986.1|2828741_2829623_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931081.1|2832735_2833110_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
WP_003812004.1|2833134_2833473_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931082.1|2833516_2835151_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
WP_010931083.1|2835189_2836536_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_003812010.1|2836643_2838065_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010931084.1|2838134_2838719_-	nitroreductase	NA	NA	NA	NA	NA
WP_005012067.1|2838821_2839772_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931085.1|2839905_2841012_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931086.1|2841022_2842120_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931087.1|2842264_2843470_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931088.1|2843476_2843998_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_023853551.1|2843994_2844477_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003819740.1|2844482_2844734_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003819741.1|2844714_2845200_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010931090.1|2845335_2848797_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_010931091.1|2848814_2849699_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931092.1|2849708_2850140_-	lipoprotein	NA	NA	NA	NA	NA
WP_003809348.1|2850386_2850890_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931094.1|2850967_2852368_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931095.1|2852442_2853318_-	membrane protein	NA	NA	NA	NA	NA
WP_023853546.1|2853314_2854322_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931097.1|2854789_2855095_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003819753.1|2855185_2855776_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930525.1|2855966_2856983_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010931098.1|2857174_2859511_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_003812014.1|2859593_2860028_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|2861174_2862125_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931099.1|2862121_2862916_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010931100.1|2862947_2863652_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931101.1|2863726_2864527_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_003809276.1|2864523_2864931_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003819722.1|2864927_2865569_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010931102.1|2865561_2867562_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010931103.1|2868822_2870154_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012067.1|2870150_2871101_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931105.1|2872806_2873073_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003812839.1|2873780_2874119_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931107.1|2878671_2879274_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931108.1|2879370_2880660_+	MFS transporter	NA	NA	NA	NA	NA
WP_003812846.1|2880717_2881449_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931109.1|2881445_2882249_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812851.1|2882245_2883334_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2883330_2884260_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812857.1|2884408_2885554_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930800.1|2885575_2886526_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2894523	2958271	4106189	transposase,protease	uncultured_Mediterranean_phage(22.22%)	55	NA	NA
WP_010931114.1|2894523_2896839_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_010931115.1|2896894_2899063_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_023853340.1|2899059_2904240_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_003820400.1|2904338_2904653_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_003812875.1|2904880_2905126_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820399.1|2905220_2905739_+	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_010931117.1|2905838_2907044_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_019247560.1|2907159_2908557_-	chloride channel protein	NA	NA	NA	NA	NA
WP_010931119.1|2908673_2909252_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_010931120.1|2909324_2910716_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_005012067.1|2910883_2911834_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812889.1|2912114_2912735_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010931122.1|2912731_2913145_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010931123.1|2913141_2914185_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003812895.1|2914240_2914429_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931124.1|2914438_2915203_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010931125.1|2915293_2915950_+	adenylate kinase	NA	NA	NA	NA	NA
WP_010931126.1|2916041_2916800_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931127.1|2916825_2918427_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931128.1|2918627_2919632_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_003812908.1|2919732_2919996_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931129.1|2920113_2920890_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012067.1|2921480_2922431_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|2924814_2925927_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|2925983_2926934_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813070.1|2927142_2927364_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_010931131.1|2927577_2928984_-	threonine synthase	NA	NA	NA	NA	NA
WP_003813074.1|2928980_2930285_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_010931132.1|2930281_2931469_-	alanine transaminase	NA	NA	NA	NA	NA
WP_003813077.1|2931685_2932138_+	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_003813079.1|2932140_2932605_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_023853657.1|2932684_2934364_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	36.7	7.3e-70
WP_003813085.1|2934468_2935446_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_010931134.1|2935525_2936494_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003813089.1|2936514_2937888_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
WP_003813091.1|2937884_2938721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931135.1|2938837_2939293_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003813094.1|2939308_2939581_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003813095.1|2939673_2939997_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_010926331.1|2940044_2940425_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003813103.1|2940644_2941442_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_010931136.1|2941598_2943461_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003820295.1|2943510_2944422_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003813109.1|2944426_2944693_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_033446289.1|2944779_2945610_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931138.1|2945784_2946750_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813114.1|2946920_2947931_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	3.6e-16
WP_010931139.1|2948078_2949230_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003814555.1|2950372_2951845_-	magnesium transporter	NA	NA	NA	NA	NA
WP_003814554.1|2951855_2952266_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010929220.1|2952329_2953376_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003814552.1|2953482_2954361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931140.1|2954374_2955571_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010931141.1|2955632_2957324_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
WP_005012067.1|2957320_2958271_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	2967030	3001011	4106189	transposase	Bacillus_virus(50.0%)	33	NA	NA
WP_010930176.1|2967030_2967981_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994659.1|2968061_2969210_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|2969266_2970217_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814535.1|2970315_2970621_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003820797.1|2970649_2971084_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931147.1|2971085_2972330_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820799.1|2972326_2973037_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446288.1|2973051_2973963_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931149.1|2974325_2974730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247890.1|2974726_2975185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247891.1|2975191_2976100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931150.1|2976096_2976963_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003814524.1|2976949_2977777_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003820806.1|2977787_2978915_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_023852748.1|2979992_2981231_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931152.1|2981272_2982535_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010931153.1|2982541_2983294_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019248355.1|2983345_2983531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820813.1|2983806_2984271_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003820814.1|2984302_2984962_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010931154.1|2985106_2987215_+	AsmA family protein	NA	NA	NA	NA	NA
WP_023852714.1|2987211_2988162_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931155.1|2988265_2988886_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003820818.1|2988989_2989730_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248356.1|2990864_2991989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247402.1|2992034_2992403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2992644_2993595_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|2994630_2995173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2995558_2996509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931157.1|2996505_2997414_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815281.1|2997540_2998377_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931158.1|2998889_2999999_+	porin	NA	NA	NA	NA	NA
WP_005012067.1|3000060_3001011_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	3401855	3465687	4106189	tRNA,transposase	Staphylococcus_phage(12.5%)	46	NA	NA
WP_005012067.1|3401855_3402806_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931344.1|3403572_3404667_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247312.1|3404659_3405994_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3405947_3406631_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024000003.1|3406656_3407820_-	acyl-CoA dehydrogenase C-terminal domain protein	NA	NA	NA	NA	NA
WP_004566224.1|3407816_3408818_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3408817_3409690_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3409686_3410436_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3410432_3411224_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3411220_3412360_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3412635_3413421_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3413454_3414237_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3414240_3414630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931352.1|3415769_3416633_+	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931353.1|3416668_3417757_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_019247959.1|3419056_3422035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3422961_3423840_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3425788_3426739_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3426735_3427203_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3427245_3428016_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|3428036_3428837_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3428847_3430257_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3430351_3431137_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931561.1|3431376_3432393_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3432500_3432893_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3433030_3433711_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3433715_3434687_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930179.1|3434782_3435733_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814239.1|3437237_3437939_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010927010.1|3437938_3439363_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_010931361.1|3440432_3441773_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003820957.1|3441888_3443652_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3443763_3444642_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3444754_3445570_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3445573_3445825_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010929632.1|3445909_3446926_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3447256_3447478_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3449838_3450756_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3451253_3452462_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3452541_3454113_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3454230_3455166_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3455354_3456299_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3456866_3462584_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3462589_3463717_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3463772_3464399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|3464670_3465687_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	3470101	3587990	4106189	tRNA,transposase	Acinetobacter_phage(22.22%)	100	NA	NA
WP_019247745.1|3470101_3470974_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_023852703.1|3471323_3472463_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3472459_3473119_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3473190_3473823_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3473852_3474371_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3474381_3475491_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3475537_3476392_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3476393_3477296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3478518_3479469_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997720.1|3481222_3482212_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931375.1|3482387_3483176_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3483172_3484204_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3484222_3484786_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_010931376.1|3484841_3486362_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_010931377.1|3486625_3487330_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_023852620.1|3487337_3488066_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3488180_3488555_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815379.1|3488597_3489887_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3489883_3491053_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3491049_3491889_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3491948_3492884_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931381.1|3493944_3494907_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3494938_3495298_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3495422_3496325_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3496326_3498099_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3498133_3498910_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_023852617.1|3500233_3501184_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815365.1|3502035_3502356_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003815364.1|3502428_3503310_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815363.1|3503426_3503669_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_010931385.1|3503806_3504277_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815348.1|3504289_3504829_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931386.1|3504863_3506405_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003817813.1|3506503_3507409_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931387.1|3507451_3508852_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003815341.1|3508861_3509284_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931388.1|3509466_3510351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931389.1|3510426_3511503_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_019247688.1|3511809_3513912_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931391.1|3513954_3516024_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_005012808.1|3516122_3517073_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3517201_3518335_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3518378_3519284_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3519286_3520987_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3520983_3521904_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3521911_3522889_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931395.1|3522947_3523982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815317.1|3525956_3526193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023995266.1|3526319_3527183_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3527271_3528093_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3528172_3528910_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931397.1|3528906_3529899_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_010931398.1|3530051_3530675_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3530719_3531868_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931400.1|3534190_3535141_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|3535481_3536432_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3536530_3537481_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443756.1|3537777_3538275_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_010931403.1|3538317_3540093_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_010931404.1|3540100_3540967_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_019249391.1|3540973_3541708_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931406.1|3542877_3543672_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815296.1|3543961_3544552_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_010931407.1|3544585_3545914_-	amidase	NA	NA	NA	NA	NA
WP_010931408.1|3545988_3547134_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014905478.1|3547245_3548244_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446233.1|3548206_3548641_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_010929974.1|3550157_3551042_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010929973.1|3551038_3552244_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929972.1|3552240_3553101_-	endonuclease	NA	NA	NA	NA	NA
WP_003807038.1|3553213_3555004_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_033446243.1|3555044_3555689_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
WP_010929971.1|3555710_3556019_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929970.1|3556184_3557471_-	membrane protein	NA	NA	NA	NA	NA
WP_010929969.1|3558904_3559855_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929968.1|3561806_3563021_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003815171.1|3563126_3564116_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_003815172.1|3564112_3564721_+	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_010929967.1|3564733_3565363_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815175.1|3565359_3565980_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003815177.1|3566011_3566803_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_010929966.1|3567654_3568110_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_010929965.1|3568128_3569055_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929964.1|3569108_3570395_-	cytochrome c	NA	NA	NA	NA	NA
WP_003815183.1|3571325_3572198_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929963.1|3572194_3573145_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_005012067.1|3573242_3574193_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_020699695.1|3574297_3574528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247263.1|3574654_3575044_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010929962.1|3575060_3577442_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_023853194.1|3577434_3578811_-	FAD binding domain in molybdopterin dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	2.4e-18
WP_010929960.1|3578826_3579822_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003819054.1|3579840_3580833_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807624.1|3581073_3581634_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_010929959.1|3581638_3581965_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_010929958.1|3582001_3582814_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003807618.1|3582824_3583907_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_010929957.1|3583993_3585268_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_010929956.1|3585990_3586941_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3587039_3587990_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	3706312	3839150	4106189	integrase,tRNA,transposase	uncultured_Mediterranean_phage(10.34%)	112	3754607:3754666	3786342:3786967
WP_010929577.1|3706312_3707263_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3707362_3708313_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929878.1|3708309_3708945_-	LysE family transporter	NA	NA	NA	NA	NA
WP_003818466.1|3709074_3709974_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_003807278.1|3710069_3710561_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_010929877.1|3710607_3711573_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929876.1|3712706_3713948_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
WP_003807287.1|3714061_3715078_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
WP_010929875.1|3715112_3715589_-	membrane protein	NA	NA	NA	NA	NA
WP_003807291.1|3715731_3716640_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_010929874.1|3716753_3717866_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.9e-21
WP_023853429.1|3717966_3718452_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003818477.1|3718588_3719839_+	kynureninase	NA	NA	NA	NA	NA
WP_003807300.1|3719940_3720453_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
WP_005013747.1|3720551_3721502_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929873.1|3721567_3722506_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
WP_010929872.1|3722528_3723155_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003818481.1|3723151_3723808_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_010929871.1|3723804_3724407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929870.1|3724413_3725001_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
WP_010929869.1|3725181_3725751_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003807313.1|3725821_3727141_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_003807315.1|3727247_3727439_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_010929868.1|3727690_3728980_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929867.1|3729134_3730130_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807322.1|3730214_3730889_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3730885_3731836_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816336.1|3731997_3733239_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
WP_010929866.1|3733235_3734180_+	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
WP_005012067.1|3734298_3735249_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853484.1|3735208_3736138_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807759.1|3736191_3736527_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929865.1|3736571_3737336_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929864.1|3737359_3738100_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929863.1|3738107_3739661_-	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
WP_010929862.1|3739695_3740673_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023853476.1|3740945_3741527_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_094145972.1|3741578_3748481_-	autotransporter BatB	NA	NA	NA	NA	NA
WP_003807750.1|3748927_3749059_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_010929858.1|3749324_3749531_-	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_010929857.1|3750535_3751195_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010929856.1|3751222_3752368_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003807743.1|3752508_3752844_+	YegP family protein	NA	NA	NA	NA	NA
WP_010929855.1|3752918_3753779_-	hypothetical protein	NA	A0A2C9D0H9	Yersinia_phage	53.6	1.7e-51
3754607:3754666	attL	GCGCCGGTCTGTCGCACCTGGCCGACCTGGAGCCGGCCGAGCCGGTGGTGCGCTACGAGC	NA	NA	NA	NA
WP_010929852.1|3755242_3755884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926414.1|3756050_3756293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929851.1|3756391_3757342_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929850.1|3757377_3757845_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
WP_010926411.1|3758078_3758456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926410.1|3758452_3758635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929849.1|3758638_3759625_+	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010929848.1|3759621_3760269_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929847.1|3760326_3760854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247983.1|3760890_3762075_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929845.1|3762085_3762427_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_010926403.1|3762539_3762740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929843.1|3762736_3763726_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010929841.1|3765212_3767183_-	DUF3220 domain-containing protein	NA	NA	NA	NA	NA
WP_003814626.1|3767424_3767823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929840.1|3767831_3768755_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3769211_3770162_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927254.1|3770392_3772084_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003816027.1|3772132_3772405_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_003816026.1|3772401_3772773_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816025.1|3772868_3773003_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_010929554.1|3773408_3774818_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_010929839.1|3774820_3775930_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929838.1|3776024_3778478_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_023853625.1|3778596_3779388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929836.1|3779507_3780935_+	amidase	NA	NA	NA	NA	NA
WP_010929835.1|3780973_3781945_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929834.1|3782363_3783527_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929833.1|3783614_3784460_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3786016_3786967_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
3786342:3786967	attR	GCGCCGGTCTGTCGCACCTGGCCGACCTGGAGCCGGCCGAGCCGGTGGTGCGCTACGAGCATCAGGCCCCCGGCGATCTGCTGCACATCGACATCAAGAAGCTGGGACGTATCCAGCGCCCTGGCCACCGGGTCACGGGCAACCGACGCGATACCGTTGAGGGGGCCGGCTGGGACTTCGTCTTCGTGGCCATCGATGACCACGCCCGCGTGGCCTTCACCGACATCCACCCCGACGAGCGCTTCCCCAGCGCCGTCCAGTTCCTCAAGGACGCAGTGGCCTACTACCAGCGCCTGGGCGTGACCATCCAGCGCTTGCTCACCGACAATGGCTCGGCCTTTCGCAGCCGCGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGCAAGGCCGAACGCTTCATCCAGTCGGCCTTGCGTGAGTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATGAAATCCTGGCTACACCACTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAGCTAG	NA	NA	NA	NA
WP_003818201.1|3787521_3787896_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|3787970_3789029_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|3789052_3790003_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929808.1|3792884_3794054_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003815953.1|3794154_3795762_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929810.1|3795808_3797830_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815955.1|3797858_3798104_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_004565905.1|3798117_3799308_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_010929811.1|3799503_3800469_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929812.1|3800491_3801631_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929813.1|3801842_3802805_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929814.1|3802928_3804953_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929815.1|3805149_3807393_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_003815964.1|3807671_3808130_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929816.1|3809057_3811679_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_010929817.1|3811742_3814370_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929818.1|3814521_3815586_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699616.1|3815585_3816356_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929819.1|3816364_3817198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818225.1|3817210_3817990_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|3818063_3819497_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929821.1|3819524_3820283_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929822.1|3820338_3822189_-	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929823.1|3822282_3822759_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853391.1|3822775_3823696_-	bestrophin	NA	NA	NA	NA	NA
WP_003818232.1|3823802_3824303_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_010929826.1|3824676_3825369_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_010929591.1|3825677_3826628_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931556.1|3826624_3830398_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_010931557.1|3830734_3832624_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931558.1|3832635_3833529_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931559.1|3833632_3834430_+	thiazole synthase	NA	NA	NA	NA	NA
WP_010931560.1|3834426_3835278_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003817656.1|3835339_3836020_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_019248789.1|3836056_3836383_+	TolC family protein	NA	NA	NA	NA	NA
WP_019247190.1|3836383_3837343_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_003815102.1|3837363_3837852_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_010931561.1|3838133_3839150_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP017164	Bordetella pertussis strain J224 chromosome, complete genome	4106189	4005260	4070170	4106189	transposase	Planktothrix_phage(40.0%)	57	NA	NA
WP_039249574.1|4005260_4005746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153302797.1|4005834_4005972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931647.1|4005964_4006945_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019248461.1|4007211_4008021_+	pertussis toxin ADP-ribosyltransferase subunit PtxA	NA	NA	NA	NA	NA
WP_014906114.1|4008060_4008741_+	pertussis toxin binding subunit PtxB	NA	NA	NA	NA	NA
WP_010929491.1|4008734_4009193_+	pertussis toxin subunit 4	NA	NA	NA	NA	NA
WP_023853616.1|4009204_4009567_+	pertussis toxin binding subunit PtxD	NA	NA	NA	NA	NA
WP_010931651.1|4009649_4010333_+	pertussis toxin binding subunit PtxE	NA	NA	NA	NA	NA
WP_010929493.1|4010388_4010697_+	type IV secretion system protein PtlA	NA	NA	NA	NA	NA
WP_010929494.1|4010715_4011030_+	type IV secretion system protein PtlB	NA	NA	NA	NA	NA
WP_010931652.1|4011026_4013501_+	type IV secretion system protein PtlC	NA	NA	NA	NA	NA
WP_010929497.1|4014895_4015081_+	type IV secretion system protein PtlI	NA	NA	NA	NA	NA
WP_010929498.1|4015059_4015761_+	type IV secretion system peptidoglycanase PtlE	NA	NA	NA	NA	NA
WP_010931654.1|4015757_4016579_+	type IV secretion system protein PtlF	NA	NA	NA	NA	NA
WP_010931655.1|4016559_4017684_+	type IV secretion system protein PtlG	NA	NA	NA	NA	NA
WP_010929500.1|4017676_4018696_+	type IV secretion system protein PtlH	NA	NA	NA	NA	NA
WP_010931656.1|4018901_4019792_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010929501.1|4020036_4020828_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815873.1|4020910_4021285_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_010931658.1|4021262_4022672_+	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_003815876.1|4022664_4024047_+	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	38.9	9.9e-57
WP_003815878.1|4024381_4025986_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931659.1|4026063_4027035_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931660.1|4027045_4027972_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931661.1|4028362_4029313_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931662.1|4029482_4030709_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010931663.1|4030908_4031775_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003815027.1|4031767_4032730_+	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010927663.1|4032830_4033781_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4033879_4034830_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|4034928_4035879_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994937.1|4035875_4037369_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003815032.1|4037365_4040473_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931665.1|4040469_4043538_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931666.1|4043534_4044785_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023853184.1|4044965_4045718_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_010931667.1|4045759_4046404_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003815047.1|4047491_4048235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815049.1|4048317_4048665_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815051.1|4048762_4049605_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815053.1|4049649_4050537_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815055.1|4050563_4050752_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_010931669.1|4050849_4052307_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010931670.1|4052293_4053820_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003815061.1|4053838_4054306_-	membrane protein	NA	NA	NA	NA	NA
WP_010931671.1|4054305_4055328_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003815064.1|4055448_4056189_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.4e-35
WP_003815066.1|4056243_4057344_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815068.1|4057345_4058536_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815070.1|4058655_4059672_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815073.1|4059990_4060662_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_010927126.1|4060658_4061567_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010931672.1|4061778_4062426_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_033446142.1|4066286_4067354_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003815084.1|4067364_4068174_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023999981.1|4068263_4069037_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010930363.1|4069219_4070170_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
