The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023656	Halomonas hydrothermalis strain Y2 chromosome, complete genome	3933432	1212408	1251274	3933432	tRNA,transposase,integrase	Paenibacillus_phage(42.86%)	39	1218274:1218295	1260084:1260105
WP_081138505.1|1212408_1212888_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_081138507.1|1213001_1214258_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_081138508.1|1214273_1214828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081138510.1|1214861_1215536_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016915559.1|1215687_1216455_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016915558.1|1216526_1217264_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_096921758.1|1217414_1218293_+	YicC family protein	NA	NA	NA	NA	NA
1218274:1218295	attL	AGATACAGAATATTGAGTGATG	NA	NA	NA	NA
WP_081138515.1|1218542_1219817_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	39.1	1.1e-75
WP_016915555.1|1219894_1220590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156808517.1|1220923_1222462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016915553.1|1222540_1222741_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	40.3	4.6e-08
WP_157779952.1|1223055_1223403_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_096921760.1|1223438_1224291_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	3.5e-20
WP_096921761.1|1224293_1224632_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_004364961.1|1225259_1225667_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_072676343.1|1225762_1226659_+	cation transporter	NA	NA	NA	NA	NA
WP_004863699.1|1226662_1227175_+	signal peptidase II	NA	NA	NA	NA	NA
WP_096921762.1|1227196_1228486_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	2.1e-85
WP_100732164.1|1228498_1228783_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050980320.1|1229333_1230812_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_081137392.1|1230808_1231558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081195058.1|1231690_1232731_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_081195060.1|1232727_1233558_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_039181150.1|1233576_1234437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096921763.1|1234533_1236138_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_096921764.1|1236803_1237373_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_096921765.1|1237452_1239732_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.9	6.8e-87
WP_096921760.1|1239794_1240648_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	3.5e-20
WP_096921766.1|1240714_1240840_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_016915534.1|1242605_1243364_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_156808516.1|1243561_1243978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050713463.1|1244110_1244881_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_026001905.1|1244890_1246714_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_009288249.1|1248102_1248768_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016915529.1|1248782_1249283_-	copper-binding protein	NA	NA	NA	NA	NA
WP_167385703.1|1249479_1249629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016915528.1|1249625_1250063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016915527.1|1250179_1250368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096921760.1|1250420_1251274_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	3.5e-20
1260084:1260105	attR	AGATACAGAATATTGAGTGATG	NA	NA	NA	NA
>prophage 2
NZ_CP023656	Halomonas hydrothermalis strain Y2 chromosome, complete genome	3933432	1927043	1971886	3933432	protease,tail,capsid,tRNA,head,portal,holin,integrase	Halomonas_phage(15.15%)	64	1922627:1922642	1965187:1965202
1922627:1922642	attL	GGTAGGCGAAGAGCTG	NA	NA	NA	NA
WP_096922149.1|1927043_1928360_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_039180327.1|1928428_1929544_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_096922150.1|1929552_1930500_-	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_096922151.1|1930540_1931272_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_039180320.1|1931373_1932552_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_039180317.1|1932633_1933059_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.2	5.1e-20
WP_016914918.1|1933227_1933554_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	42.6	3.1e-17
WP_096922152.1|1933582_1934773_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A142BZP5	Faustovirus	28.6	2.3e-30
WP_039180312.1|1934804_1935272_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_039180308.1|1935348_1936212_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_039180305.1|1936331_1937087_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_039180303.1|1937228_1938023_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_096922153.1|1938106_1939033_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.0	1.5e-40
WP_096922154.1|1939081_1940935_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	23.2	1.8e-08
WP_016914910.1|1941070_1941397_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.0	1.9e-11
WP_039180272.1|1941471_1942599_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	1.0e-88
WP_096922155.1|1942652_1943684_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_157779958.1|1943947_1944787_-|integrase	tyrosine-type recombinase/integrase	integrase	M1FN74	Enterobacteria_phage	24.5	3.2e-18
WP_096922157.1|1944813_1945146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096922158.1|1945147_1945660_-	hypothetical protein	NA	A0A1J0GUW8	Halomonas_phage	46.7	5.9e-39
WP_096922159.1|1945688_1945952_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	64.0	3.2e-09
WP_096922160.1|1945948_1946566_-	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	40.5	6.5e-16
WP_096922161.1|1946562_1946856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922162.1|1946852_1947182_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	54.5	7.6e-24
WP_096922163.1|1947178_1948132_-	recombination-associated protein RdgC	NA	A0A1J0GUV6	Halomonas_phage	66.9	1.6e-106
WP_096922164.1|1948227_1948479_-	hypothetical protein	NA	A0A1J0GUW1	Halomonas_phage	61.5	1.5e-11
WP_096922165.1|1948488_1948797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922166.1|1948793_1949090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157779959.1|1949086_1949233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922167.1|1949229_1949535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157779960.1|1949531_1949918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922169.1|1950054_1950717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922170.1|1950730_1951402_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	45.9	1.5e-45
WP_096923405.1|1951489_1951720_+	hypothetical protein	NA	A0A125RNS7	Pseudomonas_phage	60.3	1.0e-14
WP_096922171.1|1951802_1952660_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	44.7	1.5e-63
WP_096922172.1|1952656_1953586_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	26.5	6.1e-10
WP_096922173.1|1953572_1954220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922174.1|1954221_1954974_+	hypothetical protein	NA	A0A2H4J111	uncultured_Caudovirales_phage	40.0	6.9e-28
WP_096922175.1|1954970_1955249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922176.1|1955509_1955803_+	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	50.0	7.3e-18
WP_096922177.1|1955799_1956060_+	hypothetical protein	NA	A0A1J0GUZ5	Halomonas_phage	68.6	1.5e-30
WP_096922178.1|1956056_1956578_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	43.0	8.1e-20
WP_096922179.1|1956598_1957132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922180.1|1957145_1957679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922181.1|1957668_1958052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157779961.1|1958041_1958212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096922183.1|1958870_1959422_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	54.8	2.0e-40
WP_096922184.1|1959449_1959800_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	46.4	4.3e-17
WP_096922185.1|1959796_1960249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922186.1|1960378_1961323_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	42.2	3.2e-06
WP_096922187.1|1961529_1962030_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	44.8	2.6e-31
WP_096922188.1|1962022_1964098_+	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	52.8	4.2e-200
WP_096922189.1|1964106_1964334_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096922190.1|1964335_1965835_+|portal	phage portal protein	portal	D4HTU3	Vibrio_phage	42.6	4.6e-100
1965187:1965202	attR	GGTAGGCGAAGAGCTG	NA	NA	NA	NA
WP_096922191.1|1965837_1966989_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	39.1	4.9e-25
WP_096922192.1|1967024_1967393_+|head	head decoration protein	head	NA	NA	NA	NA
WP_096922193.1|1967458_1968442_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	51.1	5.7e-91
WP_096922194.1|1968453_1968759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922195.1|1968774_1969377_+	hypothetical protein	NA	A0A067ZG41	Vibrio_phage	29.7	2.2e-05
WP_096922196.1|1969373_1969772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922197.1|1969831_1970017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922198.1|1970009_1970957_+	hypothetical protein	NA	M4ST92	Rhodobacter_phage	30.1	1.3e-26
WP_096922199.1|1971035_1971377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096922200.1|1971412_1971886_+	hypothetical protein	NA	A0A1B0T6D6	Thiobacimonas_phage	48.1	5.0e-08
>prophage 3
NZ_CP023656	Halomonas hydrothermalis strain Y2 chromosome, complete genome	3933432	2086972	2097899	3933432	tRNA	Klosneuvirus(33.33%)	8	NA	NA
WP_096922340.1|2086972_2087836_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	6.9e-48
WP_096922342.1|2087904_2089194_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.5	7.4e-131
WP_039180081.1|2089668_2089992_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_096922345.1|2090143_2092711_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.3	2.8e-28
WP_096922348.1|2092834_2093359_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.4	1.2e-34
WP_039180074.1|2093448_2094510_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	5.2e-114
WP_096922350.1|2094545_2095019_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_096922352.1|2095286_2097899_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.3e-81
>prophage 4
NZ_CP023656	Halomonas hydrothermalis strain Y2 chromosome, complete genome	3933432	2601554	2608360	3933432		Morganella_phage(16.67%)	7	NA	NA
WP_096922641.1|2601554_2602853_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	40.2	2.6e-75
WP_016914453.1|2602849_2603293_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	37.3	3.3e-14
WP_096922642.1|2603636_2604521_+	alpha/beta hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	32.4	2.5e-05
WP_139788550.1|2604580_2605588_+	patatin	NA	A0A1V0SCG0	Catovirus	28.0	1.6e-08
WP_096922643.1|2605589_2606153_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	35.0	3.5e-16
WP_016914448.1|2606295_2607255_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_096922644.1|2607268_2608360_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.3	2.9e-83
>prophage 5
NZ_CP023656	Halomonas hydrothermalis strain Y2 chromosome, complete genome	3933432	3823195	3828265	3933432		Escherichia_phage(33.33%)	6	NA	NA
WP_096923259.1|3823195_3823744_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.1	7.2e-51
WP_096923260.1|3823838_3824741_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	7.1e-104
WP_096923261.1|3824848_3825745_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.7	1.8e-22
WP_096923262.1|3825795_3826161_-	GxxExxY protein	NA	G9E611	Micromonas_pusilla_virus	37.6	1.4e-10
WP_096923263.1|3826289_3827354_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.2	4.0e-98
WP_096923461.1|3827392_3828265_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	1.3e-06
