The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010767	Phaeobacter piscinae strain P13 chromosome, complete genome	3617848	1747861	1892057	3617848	transposase,protease,head,integrase,tail,tRNA,capsid,portal,plate,terminase	Escherichia_phage(23.91%)	150	1826008:1826063	1863318:1863373
WP_096871411.1|1747861_1748932_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_096871412.1|1749036_1752765_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_096871413.1|1752865_1753327_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_096871414.1|1753468_1754350_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_096871415.1|1754755_1756087_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	45.0	2.5e-17
WP_040169361.1|1756076_1756619_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_096871416.1|1756880_1758125_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_096871417.1|1758368_1759865_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_096871418.1|1759952_1760960_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_040178650.1|1761160_1761712_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.1	9.8e-40
WP_096871419.1|1761704_1762211_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.0	3.3e-42
WP_096873140.1|1762392_1763583_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014880143.1|1763860_1764160_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_040178651.1|1764462_1765476_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_096871420.1|1765492_1766878_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_096871421.1|1766890_1768228_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_096871422.1|1768410_1769298_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_040169387.1|1769508_1770324_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_096871423.1|1770591_1770912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871424.1|1770924_1774881_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	37.9	7.1e-225
WP_096871425.1|1774880_1775351_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.3	1.0e-29
WP_096871426.1|1775347_1776298_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.5	1.5e-51
WP_096871427.1|1776297_1776930_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	45.7	5.9e-49
WP_096871428.1|1776945_1777602_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	37.2	1.3e-14
WP_096871429.1|1777594_1777852_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_096871430.1|1777848_1778202_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_014880167.1|1778216_1778630_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_096871431.1|1778736_1779150_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_040169406.1|1779146_1779518_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_192870590.1|1779514_1780162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871432.1|1780347_1781532_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	2.0e-61
WP_096873142.1|1781580_1782198_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	53.3	3.8e-32
WP_096871433.1|1782233_1782452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871434.1|1782444_1783638_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.1	1.1e-59
WP_096871435.1|1783842_1785135_-	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	43.3	9.9e-75
WP_040169417.1|1785106_1785448_-	recombinase	NA	NA	NA	NA	NA
WP_096706488.1|1785739_1786894_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_096871436.1|1786893_1788159_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_096871437.1|1788420_1789434_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_096871438.1|1789726_1790470_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_005982462.1|1790634_1790868_-	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_040169440.1|1791548_1792286_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_096871439.1|1792371_1793304_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_096871440.1|1793489_1794791_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_096871441.1|1795115_1795649_+	VOC family protein	NA	NA	NA	NA	NA
WP_096871442.1|1795871_1796447_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_096871443.1|1796683_1797280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123619046.1|1797545_1797785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874885.1|1797849_1798203_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005982441.1|1798231_1798459_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_040169455.1|1798471_1799086_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_040169456.1|1799318_1799501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871445.1|1799822_1800293_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_096873143.1|1800441_1802400_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_096871446.1|1802698_1803967_+	hypothetical protein	NA	M4SNJ8	Pseudoalteromonas_phage	26.5	2.8e-05
WP_096873144.1|1804183_1805515_-	trigger factor	NA	NA	NA	NA	NA
WP_096871447.1|1805782_1806913_-	porin	NA	NA	NA	NA	NA
WP_096871448.1|1807266_1809471_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	7.4e-14
WP_192870560.1|1809816_1810275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958079.1|1810328_1811627_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096871449.1|1811669_1813490_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_096871450.1|1813580_1813859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871451.1|1813855_1814389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871452.1|1814571_1815504_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	36.4	5.3e-46
WP_096871453.1|1815833_1816076_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_158524830.1|1816065_1816386_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_096871455.1|1816382_1816811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871456.1|1816821_1817331_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_145958069.1|1817522_1818308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958070.1|1818356_1818584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958071.1|1818607_1819012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871460.1|1819219_1819840_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	51.9	1.1e-34
WP_096871461.1|1819887_1822176_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096871462.1|1822385_1822688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871463.1|1822726_1823509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145958073.1|1823693_1823876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958074.1|1824095_1824464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871465.1|1824460_1826029_+	recombinase family protein	NA	NA	NA	NA	NA
1826008:1826063	attL	TGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
WP_096873145.1|1826465_1826906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871466.1|1827242_1828250_-	late control protein D	NA	A0A088FRU7	Escherichia_phage	44.8	2.9e-74
WP_072504833.1|1828240_1828462_-|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	56.1	9.7e-15
WP_096873146.1|1828430_1828841_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	53.7	8.1e-31
WP_096871467.1|1828840_1831336_-|tail	phage tail tape measure protein	tail	A0A0U2BXT9	Paracoccus_phage	30.1	8.1e-25
WP_052463898.1|1831450_1831744_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	51.6	8.9e-08
WP_096871468.1|1831753_1832260_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.6	3.8e-46
WP_096871469.1|1832259_1833477_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.3	3.4e-133
WP_096871470.1|1833543_1833993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871471.1|1833993_1834404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871472.1|1834428_1835586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871473.1|1835585_1836143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871474.1|1836135_1836738_-|tail	phage tail protein I	tail	A0A088FVH1	Escherichia_phage	39.3	3.3e-25
WP_096871475.1|1836730_1837630_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	57.6	7.3e-85
WP_096871476.1|1837629_1837968_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	64.0	8.4e-34
WP_096871478.1|1838307_1838733_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_096871479.1|1838729_1839263_-	hypothetical protein	NA	D5LGZ6	Escherichia_phage	44.2	2.9e-33
WP_096871480.1|1839266_1839860_-|tail	phage tail protein	tail	A0A193GYC6	Enterobacter_phage	46.4	3.7e-37
WP_096871481.1|1839819_1840131_-	hypothetical protein	NA	A0A193GYM3	Enterobacter_phage	42.9	2.7e-18
WP_096871482.1|1840130_1840361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871483.1|1840435_1842466_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	50.1	8.8e-171
WP_096873147.1|1842458_1843985_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.8	4.2e-133
WP_096871484.1|1844050_1844581_-	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	45.1	2.6e-34
WP_096871485.1|1844590_1846540_-|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	63.0	1.2e-225
WP_096871486.1|1846536_1847088_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	50.8	5.6e-35
WP_096871487.1|1847203_1847644_-	bacteriophage spanin2 family protein	NA	NA	NA	NA	NA
WP_096871488.1|1847643_1848372_-	lysozyme	NA	A0A0K1LL70	Rhodobacter_phage	42.8	7.9e-29
WP_027247879.1|1848413_1848650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871489.1|1849010_1849469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871490.1|1849593_1850412_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_096871491.1|1850782_1851250_-	RidA family protein	NA	NA	NA	NA	NA
WP_158524473.1|1851833_1852784_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_096871493.1|1853138_1853924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871494.1|1855200_1855767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871495.1|1855776_1856193_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	41.8	2.8e-07
WP_096871496.1|1856202_1857249_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	58.3	9.7e-97
WP_096871497.1|1857241_1857556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096871498.1|1857555_1858470_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096871499.1|1858855_1859350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871500.1|1859358_1859682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037302281.1|1859997_1860300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871502.1|1860530_1860800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145958076.1|1860944_1861154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871504.1|1861298_1861991_+	hypothetical protein	NA	A0A0U2BXK1	Paracoccus_phage	75.8	9.9e-98
WP_096871505.1|1862023_1862227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871506.1|1862220_1863222_+|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	23.8	2.6e-06
WP_096871507.1|1863518_1865204_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
1863318:1863373	attR	TGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
WP_014874894.1|1865396_1865735_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_096871508.1|1865828_1867235_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_096871509.1|1867752_1868778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096871510.1|1868795_1869560_-	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_096873148.1|1869747_1871091_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_096871511.1|1871168_1871729_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096871512.1|1871824_1873081_+	OsmC family protein	NA	NA	NA	NA	NA
WP_040178692.1|1873359_1874664_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.2	6.6e-18
WP_096871513.1|1874852_1875458_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096871514.1|1875534_1876737_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_096871515.1|1877121_1878057_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_096871516.1|1878071_1878803_-	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_096871517.1|1879048_1881736_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_096873149.1|1881974_1882310_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_096871518.1|1882387_1882927_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_040169641.1|1882919_1883090_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_014874910.1|1883089_1883821_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_040169525.1|1883866_1884523_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_096871519.1|1884519_1885146_-	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	30.2	1.3e-08
WP_096871520.1|1885242_1885596_-	Mth938-like domain-containing protein	NA	NA	NA	NA	NA
WP_096871521.1|1885764_1886733_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.1	1.8e-60
WP_096871522.1|1886734_1888396_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.0	1.6e-05
WP_040169532.1|1888430_1888715_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	53.8	1.2e-20
WP_158524831.1|1889137_1890655_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096871524.1|1890764_1892057_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	6.8e-84
>prophage 2
NZ_CP010767	Phaeobacter piscinae strain P13 chromosome, complete genome	3617848	2389207	2456470	3617848	transposase,protease,integrase	Acinetobacter_phage(18.18%)	53	2431471:2431490	2462540:2462559
WP_040173890.1|2389207_2391529_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	1.6e-171
WP_096871966.1|2391533_2392499_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_096871968.1|2392686_2393271_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_096871970.1|2393281_2395249_-	peptidoglycan -binding protein	NA	NA	NA	NA	NA
WP_096871971.1|2395252_2396434_-	biopolymer transporter ExbB	NA	NA	NA	NA	NA
WP_024096351.1|2396512_2397043_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_096871972.1|2397107_2398112_+	DUF2125 domain-containing protein	NA	NA	NA	NA	NA
WP_096871974.1|2398108_2398972_-	extensin family protein	NA	NA	NA	NA	NA
WP_096871976.1|2398968_2399889_-	prephenate/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096871978.1|2399885_2400971_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	3.5e-17
WP_014875429.1|2401127_2401589_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_082035080.1|2401631_2402204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014875431.1|2402411_2403032_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_096871980.1|2403279_2404356_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_096871982.1|2404490_2405635_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_096871983.1|2406942_2407611_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096871985.1|2407607_2408849_-	histidine kinase	NA	NA	NA	NA	NA
WP_158524835.1|2408881_2410000_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096871988.1|2409996_2413041_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_096871989.1|2414628_2415291_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096871992.1|2415378_2416437_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_096871994.1|2416558_2417311_-	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.2	3.4e-11
WP_096871996.1|2417317_2418373_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_158524836.1|2418372_2419113_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096872000.1|2419350_2421381_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.3	1.9e-08
WP_123618689.1|2423867_2424167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872002.1|2424150_2424555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872004.1|2424551_2425175_+	DedA family protein	NA	NA	NA	NA	NA
WP_096872006.1|2425238_2425898_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096872007.1|2425878_2427222_+	hypothetical protein	NA	A0A2K9L5I4	Tupanvirus	22.9	8.6e-05
WP_096872009.1|2427394_2429683_+	ABC transporter ATP-binding protein/permease	NA	A0A285PWH2	Cedratvirus	32.0	2.7e-14
2431471:2431490	attL	TTTGCTTCCACAGTGCTTCC	NA	NA	NA	NA
WP_096872013.1|2431519_2432698_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	35.4	3.6e-55
WP_096872015.1|2432923_2433643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096790296.1|2433741_2433975_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039982563.1|2434094_2434313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872017.1|2434493_2435642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872020.1|2436183_2436693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096872022.1|2437333_2438824_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_096872024.1|2438820_2440461_-	amidohydrolase	NA	NA	NA	NA	NA
WP_096872026.1|2440471_2441401_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	6.8e-09
WP_096872029.1|2441397_2442375_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.4	6.2e-13
WP_096872030.1|2442371_2443250_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096872032.1|2443263_2444202_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096872034.1|2444220_2445783_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096872036.1|2445805_2447830_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_096872038.1|2447895_2448687_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096872040.1|2448981_2449278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096872042.1|2449754_2450174_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.0	2.2e-28
WP_096872045.1|2451057_2451960_-	DMT family transporter	NA	NA	NA	NA	NA
WP_096872047.1|2452043_2452748_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096873180.1|2452849_2453722_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158524837.1|2454901_2455438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040180999.1|2455837_2456470_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	28.3	1.5e-07
2462540:2462559	attR	TTTGCTTCCACAGTGCTTCC	NA	NA	NA	NA
>prophage 1
NZ_CP010769	Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence	133727	19687	75605	133727	protease,transposase,integrase	Bacillus_phage(25.0%)	56	10000:10016	80481:80497
10000:10016	attL	CAAACCGCAGATCGCGG	NA	NA	NA	NA
WP_024096534.1|19687_20686_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.3	3.3e-17
WP_024096535.1|20682_21627_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_036563100.1|21623_22535_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	27.2	5.4e-11
WP_096873423.1|23461_23851_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_096873424.1|24009_25992_+	ParB/RepB/Spo0J family partition protein	NA	A0A0F7L836	uncultured_marine_virus	33.5	5.1e-06
WP_096873425.1|26066_26660_+	regulator	NA	NA	NA	NA	NA
WP_096873426.1|27544_27871_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_096873427.1|27867_28386_+	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_096873428.1|28533_28686_+	StaA	NA	NA	NA	NA	NA
WP_192870624.1|30134_30413_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	48.6	1.0e-08
WP_096873431.1|30513_30819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873507.1|30944_31673_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_096873508.1|31956_32364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873432.1|32512_33094_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_096873433.1|33211_37057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096873434.1|37913_38843_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	33.9	6.3e-07
WP_096873436.1|39378_39585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873437.1|40148_40742_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096873438.1|40728_43080_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096873439.1|43088_45071_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_096873440.1|45111_45366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873441.1|45553_46123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873442.1|46156_47329_+	TMEM43 family protein	NA	NA	NA	NA	NA
WP_096873443.1|47362_47830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873444.1|47841_48663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873445.1|48673_49282_+	DUF4453 domain-containing protein	NA	NA	NA	NA	NA
WP_096873446.1|49290_49707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873447.1|49709_50618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873448.1|50623_51667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873509.1|51741_52500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873449.1|52800_53601_+	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_096873450.1|54593_55670_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_096873451.1|55682_56096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009807516.1|56092_56287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096873452.1|56283_57270_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_096873453.1|57274_58654_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_067294495.1|58650_59346_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_096873454.1|59348_60005_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_096873455.1|60019_60829_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_192870623.1|60828_61983_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	57.0	1.2e-26
WP_096873457.1|62136_64500_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008327373.1|64489_64768_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_096873510.1|64760_65045_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_096873458.1|65152_65773_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.5	2.0e-20
WP_012187165.1|65816_66170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096873459.1|66373_66634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096873460.1|66758_67016_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096873462.1|67736_69707_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_096873463.1|69822_70299_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_096873464.1|70311_70935_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_096873465.1|71043_71958_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096873466.1|71983_72886_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096873467.1|73032_73419_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_096873468.1|73490_73925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102898455.1|73950_74337_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_040180999.1|74972_75605_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	27.1	7.1e-10
80481:80497	attR	CCGCGATCTGCGGTTTG	NA	NA	NA	NA
>prophage 1
NZ_CP010775	Phaeobacter piscinae strain P13 plasmid pP13_h, complete sequence	36658	6385	16626	36658	transposase	Streptococcus_phage(33.33%)	9	NA	NA
WP_096873665.1|6385_7495_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	32.5	8.9e-08
WP_000480968.1|7647_8484_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|8483_9287_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000904906.1|9352_9967_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_096873666.1|10087_12979_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.7	1.1e-185
WP_096873665.1|13058_14168_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	32.5	8.9e-08
WP_065335167.1|14665_15241_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	38.9	1.3e-26
WP_065335168.1|15369_15705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096873667.1|15762_16626_-	class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	50.7	4.4e-71
>prophage 2
NZ_CP010775	Phaeobacter piscinae strain P13 plasmid pP13_h, complete sequence	36658	19795	29071	36658	transposase,integrase	Clostridioides_phage(16.67%)	7	26137:26167	29572:29602
WP_096873670.1|19795_22063_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	35.0	1.5e-102
WP_078527637.1|22254_23610_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	5.0e-45
WP_096873671.1|23697_24660_+	hypothetical protein	NA	Q8V6N5	Halorubrum_phage	26.6	5.7e-11
WP_071974167.1|24902_25655_+	Bro-N domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	52.8	4.8e-29
26137:26167	attL	CCCATAATGCCGATGTTCAGATTATGCCGCG	NA	NA	NA	NA
WP_024096534.1|26223_27222_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.3	3.3e-17
WP_024096535.1|27218_28163_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_036563100.1|28159_29071_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	27.2	5.4e-11
29572:29602	attR	CGCGGCATAATCTGAACATCGGCATTATGGG	NA	NA	NA	NA
