The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010643	Phaeobacter piscinae strain P36 chromosome, complete genome	3613164	1780298	1903433	3613164	plate,integrase,terminase,portal,protease,tail,head,tRNA,capsid	Escherichia_phage(25.58%)	136	1859581:1859636	1903529:1903584
WP_096868863.1|1780298_1781369_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_096868864.1|1781472_1785207_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_096868865.1|1785307_1785769_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_096868866.1|1785910_1786792_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_040169623.1|1787195_1788527_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	45.0	2.5e-17
WP_040169361.1|1788516_1789059_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_096868867.1|1789319_1790564_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_096868868.1|1790807_1792304_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_096868869.1|1792390_1793398_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_096868870.1|1793598_1794150_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.1	1.3e-39
WP_040169371.1|1794142_1794649_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	55.0	4.3e-42
WP_096868871.1|1794830_1796021_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_040169626.1|1796298_1796598_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_014874852.1|1796898_1797912_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_096789250.1|1797928_1799308_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_096868872.1|1799320_1800673_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_096868873.1|1801247_1801430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868874.1|1801645_1802482_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_096868875.1|1802520_1803525_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096868876.1|1804063_1804951_-	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_040169387.1|1805164_1805980_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_040169388.1|1806247_1806568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868877.1|1806580_1810537_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	37.8	2.0e-227
WP_096789256.1|1810536_1811007_-	C40 family peptidase	NA	F4YXU4	Roseobacter_phage	43.0	6.0e-30
WP_096868878.1|1811003_1811954_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	36.1	3.9e-52
WP_096789258.1|1811953_1812586_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	9.1e-58
WP_040169393.1|1812601_1813258_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	36.6	1.3e-14
WP_040169395.1|1813250_1813508_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_040169397.1|1813504_1813894_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_014874865.1|1813908_1814322_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_096868879.1|1814427_1814841_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_040169406.1|1814837_1815209_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_192870801.1|1815205_1815853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868880.1|1816039_1817224_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	38.4	3.9e-62
WP_096869818.1|1817272_1817890_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	54.7	3.4e-33
WP_096868881.1|1817925_1818144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868882.1|1818136_1819330_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.1	1.4e-59
WP_096789263.1|1819534_1820827_-	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	43.1	4.9e-74
WP_040169417.1|1820798_1821140_-	recombinase	NA	NA	NA	NA	NA
WP_096868883.1|1821432_1822587_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_040178664.1|1822586_1823852_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_096868884.1|1824112_1825129_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_040169423.1|1825295_1826039_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_005982462.1|1826203_1826437_-	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_040169440.1|1827099_1827837_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_096868885.1|1827922_1828855_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_096868886.1|1829040_1830345_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_040180993.1|1830564_1830990_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_082035339.1|1831070_1831406_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_040169449.1|1831690_1832266_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_096868887.1|1832501_1833098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014874885.1|1833666_1834020_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005982441.1|1834048_1834276_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_040169455.1|1834288_1834903_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_040169456.1|1835137_1835320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040169457.1|1835641_1836112_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_040178749.1|1836261_1838220_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_096868889.1|1838518_1839787_+	hypothetical protein	NA	M4SNJ8	Pseudoalteromonas_phage	27.2	2.8e-05
WP_096869819.1|1840002_1841334_-	trigger factor	NA	NA	NA	NA	NA
WP_096868890.1|1841602_1842733_-	porin	NA	NA	NA	NA	NA
WP_096868891.1|1843086_1845288_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	8.2e-13
WP_096868892.1|1845882_1846575_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_096868893.1|1847231_1847558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868894.1|1847636_1848077_+	cytochrome c	NA	NA	NA	NA	NA
WP_096868895.1|1848078_1849458_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_096868896.1|1849454_1849859_+	cytochrome c	NA	NA	NA	NA	NA
WP_192870802.1|1849934_1850759_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_192870803.1|1850786_1851548_+	glutaredoxin	NA	NA	NA	NA	NA
WP_158524464.1|1851519_1851987_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_096868898.1|1852045_1852924_-	CopD family protein	NA	NA	NA	NA	NA
WP_096868899.1|1852926_1853289_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_096868900.1|1853380_1854127_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_096868901.1|1854126_1855881_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_096868902.1|1856063_1856417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040169491.1|1857035_1857362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040169493.1|1857544_1858303_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096868903.1|1858284_1859007_-	hypothetical protein	NA	NA	NA	NA	NA
1859581:1859636	attL	TGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
WP_040182996.1|1860181_1861147_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_040182994.1|1861143_1861851_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	30.8	2.2e-07
WP_096868904.1|1862961_1863747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868905.1|1864396_1866052_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_096868906.1|1866309_1867317_-	late control protein D	NA	A0A088FRU7	Escherichia_phage	44.4	3.2e-73
WP_096868907.1|1867307_1867529_-|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	54.5	2.2e-14
WP_096869822.1|1867497_1867908_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	52.8	2.3e-30
WP_096868908.1|1867907_1870403_-|tail	phage tail tape measure protein	tail	A0A0U2BXT9	Paracoccus_phage	29.3	1.6e-17
WP_096868909.1|1870517_1870811_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	51.6	6.8e-08
WP_096868910.1|1870820_1871327_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	54.2	1.3e-46
WP_096868911.1|1871326_1872544_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.5	4.7e-135
WP_096868912.1|1872643_1873126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868913.1|1873137_1874007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868914.1|1874003_1874342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868915.1|1874346_1874904_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096869823.1|1874900_1875620_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	47.3	2.9e-31
WP_096868916.1|1875612_1876512_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	51.4	1.0e-78
WP_096868917.1|1876511_1876850_-	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	66.7	2.6e-35
WP_044041510.1|1876899_1877190_-	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	58.6	1.1e-23
WP_061047705.1|1877189_1877615_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_096868918.1|1877611_1878145_-	hypothetical protein	NA	D5LGZ6	Escherichia_phage	44.2	6.6e-33
WP_096868919.1|1878148_1878742_-|tail	phage tail protein	tail	A0A193GYC6	Enterobacter_phage	46.4	6.4e-37
WP_096868920.1|1878701_1879013_-	hypothetical protein	NA	V5YTH3	Pseudomonas_phage	45.7	1.8e-19
WP_096868921.1|1879012_1879243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868922.1|1879317_1881348_-|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	50.1	6.8e-171
WP_096868923.1|1881340_1882870_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.5	2.1e-132
WP_096868924.1|1882935_1883466_-	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	44.5	1.2e-34
WP_096868925.1|1883475_1885425_-|terminase	phage terminase large subunit family protein	terminase	D5LH04	Escherichia_phage	62.5	1.9e-223
WP_096869824.1|1885421_1885982_-|terminase	terminase small subunit	terminase	A0A193GYK5	Enterobacter_phage	49.1	6.7e-36
WP_096868926.1|1886154_1886538_-	bacteriophage spanin2 family protein	NA	NA	NA	NA	NA
WP_096868927.1|1886537_1887266_-	lysozyme	NA	A0A0K1LL70	Rhodobacter_phage	42.8	7.9e-29
WP_027247879.1|1887307_1887544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123580062.1|1887897_1888086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096869825.1|1888235_1888760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868928.1|1889307_1890246_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096868929.1|1890323_1890890_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_040180999.1|1891026_1891659_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	28.3	1.5e-07
WP_096789340.1|1891833_1892406_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040180998.1|1892402_1892942_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_096868930.1|1893155_1893614_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_096868931.1|1894441_1895008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868932.1|1895017_1895437_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	41.8	2.2e-07
WP_096868933.1|1895433_1895859_-	hypothetical protein	NA	A0A1X9HXA5	Ruegeria_phage	69.7	3.5e-45
WP_096868934.1|1895867_1896131_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	92.2	8.8e-31
WP_096868935.1|1896130_1896439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096868936.1|1896438_1897350_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096868937.1|1897346_1897949_-	SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	49.4	1.2e-43
WP_158524465.1|1897932_1898106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082760618.1|1898102_1898315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040182933.1|1898433_1898748_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096868938.1|1898912_1899569_+	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_096868939.1|1899628_1900216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123580063.1|1900340_1900652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868941.1|1900648_1900900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868942.1|1900899_1901211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868943.1|1901222_1901513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868944.1|1901550_1902201_+	hypothetical protein	NA	A0A219YFC7	Ochrobactrum_phage	40.2	7.5e-31
WP_096868945.1|1902234_1902438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096868946.1|1902431_1903433_+|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	23.4	3.4e-06
1903529:1903584	attR	TGGTGCGGGTGAAGGGACTTGAACCCCCACGCCTTGCGGCGCCAGAACCTAAATCT	NA	NA	NA	NA
>prophage 1
NZ_CP010645	Phaeobacter piscinae strain P36 plasmid pP36_b, complete sequence	117673	10247	76548	117673	transposase	Emiliania_huxleyi_virus(10.0%)	59	NA	NA
WP_096870019.1|10247_11273_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158524479.1|13713_14604_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_158524480.1|14596_15511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123580080.1|16149_16581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870025.1|17162_17621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870098.1|18453_18837_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_096870026.1|19143_20991_+	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	34.4	1.7e-72
WP_096870027.1|21104_21641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870029.1|22121_22421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158524481.1|23378_23531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870031.1|24155_24815_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_096870032.1|24827_26198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870033.1|26386_26863_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096870099.1|27003_28038_+	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.9	9.8e-17
WP_096870034.1|28041_28836_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_096870035.1|28838_29165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870036.1|29171_30356_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_096870037.1|30503_31844_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	24.5	7.7e-30
WP_096870038.1|32169_32547_+	glyoxalase	NA	NA	NA	NA	NA
WP_096870039.1|33493_34375_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	43.4	3.6e-52
WP_096870040.1|34611_34803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870041.1|34774_35515_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	27.4	2.7e-08
WP_096870042.1|35518_36559_+	ParB/RepB/Spo0J family partition protein	NA	A0A160DCL1	Gordonia_phage	35.8	3.8e-08
WP_096870043.1|36571_36859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870044.1|37092_37647_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_096870045.1|37643_38825_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096870046.1|39656_40859_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.2	3.2e-96
WP_096870100.1|40971_42321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096870047.1|42904_44065_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_123580081.1|44731_45430_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.9	7.8e-10
WP_096870049.1|45680_45905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_102789791.1|45919_46342_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096870050.1|46506_48048_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_096870051.1|48176_49304_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_096870052.1|49395_49908_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_096870053.1|49897_51616_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_123580082.1|51615_53016_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_096870055.1|54046_54451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870056.1|54956_57278_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	27.7	3.3e-12
WP_096870057.1|57274_58348_+	endonuclease	NA	NA	NA	NA	NA
WP_096870058.1|58427_59975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096870059.1|59967_62094_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_096870101.1|62090_63119_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_192870853.1|63124_63730_-	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_096870061.1|64287_65139_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_096870062.1|65135_65822_-	virB8 family protein	NA	NA	NA	NA	NA
WP_102871044.1|65818_66019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096870064.1|66065_66959_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_096870065.1|66989_67253_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_096870066.1|67262_67979_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_096870067.1|67975_70330_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_096870068.1|70329_70659_-	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_096870069.1|70678_70966_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_096870102.1|70978_71527_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_102871045.1|71666_71951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192870854.1|72263_72974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870071.1|73283_74513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870072.1|74509_74899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096870073.1|75320_76548_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.3e-91
