The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023563	Brachybacterium vulturis strain VM2412 chromosome, complete genome	3796663	300452	361815	3796663	protease,transposase	Mycobacterium_phage(25.0%)	56	NA	NA
WP_157773307.1|300452_301046_+|transposase	transposase family protein	transposase	A0A2H4PDF8	Mycobacterium_phage	55.1	3.1e-15
WP_157773535.1|301470_302868_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	50.3	4.9e-112
WP_096804157.1|303649_303841_-	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_096801455.1|303849_304791_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_096801456.1|305113_306280_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.5	2.1e-07
WP_096801457.1|306284_308354_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	31.7	8.5e-28
WP_096801458.1|308628_309705_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	58.7	9.2e-26
WP_157773536.1|310622_311240_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_096801459.1|311269_311722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801460.1|311706_312633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157773308.1|312745_313975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096801462.1|314139_315570_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.9	7.7e-36
WP_096801463.1|315645_316971_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_096801464.1|317146_318592_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096801465.1|318706_319780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096804158.1|319816_321019_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_096801466.1|321021_322053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096801467.1|322150_323899_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_096801468.1|323999_325334_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_096801469.1|325400_326339_-	serine hydrolase	NA	NA	NA	NA	NA
WP_096801470.1|326715_327795_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096801471.1|327788_328547_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	2.0e-27
WP_096801472.1|328543_329749_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_096801473.1|329920_330985_-|protease	CAAX protease	protease	NA	NA	NA	NA
WP_096801474.1|331150_331561_+	VOC family protein	NA	NA	NA	NA	NA
WP_096801475.1|331639_332632_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096801476.1|332774_334055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801477.1|334039_334786_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	26.3	6.2e-05
WP_096801478.1|334874_335111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096801479.1|335207_336089_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_096801480.1|336565_337054_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_157773309.1|337058_337544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096801482.1|337798_338287_+	DUF4383 domain-containing protein	NA	NA	NA	NA	NA
WP_096801483.1|338344_338893_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096801484.1|339113_339482_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096804159.1|339550_341203_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_096801485.1|341401_342652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801486.1|342834_343263_+	VOC family protein	NA	NA	NA	NA	NA
WP_096801487.1|343541_344456_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096801488.1|344542_344947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801489.1|344960_345245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096801490.1|345435_346044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096801491.1|346046_347204_+	serine hydrolase	NA	NA	NA	NA	NA
WP_096801492.1|347200_347581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801493.1|347628_348417_-	esterase	NA	NA	NA	NA	NA
WP_096804160.1|348694_349024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157773310.1|349008_349830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801495.1|349826_351305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801496.1|351291_351930_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_096804161.1|352106_353582_+	glycosidase	NA	NA	NA	NA	NA
WP_096801497.1|353727_354915_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	22.7	4.0e-06
WP_096801498.1|354924_355278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096801499.1|355492_357319_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	1.6e-33
WP_096801500.1|357315_359142_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	6.5e-48
WP_096801501.1|359608_360232_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_096801502.1|360897_361815_-|protease	rhomboid family intramembrane serine protease	protease	A0A2K9V8Q3	Bandra_megavirus	30.3	1.0e-04
>prophage 2
NZ_CP023563	Brachybacterium vulturis strain VM2412 chromosome, complete genome	3796663	3222411	3284344	3796663	integrase,tRNA,protease	Tupanvirus(30.77%)	54	3276267:3276309	3284649:3284691
WP_096803704.1|3222411_3223161_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_096803705.1|3223169_3223754_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_096803706.1|3223750_3224794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096803707.1|3224753_3224996_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_096803708.1|3224997_3225477_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_096803709.1|3225739_3226864_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_096803710.1|3227307_3228903_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_096803711.1|3229056_3231402_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_096803712.1|3231391_3231730_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_096803713.1|3231726_3233127_-	ammonium transporter	NA	NA	NA	NA	NA
WP_096803714.1|3233518_3235066_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	31.9	2.2e-12
WP_157773499.1|3235173_3235335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096803715.1|3235414_3235840_-	nucleoside-diphosphate kinase	NA	A0A2K9L595	Tupanvirus	45.2	1.1e-22
WP_096803716.1|3235886_3236303_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_157773591.1|3236305_3237655_-	dihydrofolate synthase	NA	NA	NA	NA	NA
WP_157773500.1|3237837_3238662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803719.1|3238661_3240233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157773501.1|3240263_3240707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157773592.1|3240800_3242057_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_096803721.1|3242420_3245723_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	32.2	1.2e-153
WP_096803722.1|3246179_3246407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803723.1|3246540_3246813_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_096803724.1|3246848_3247073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096803725.1|3247271_3249122_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.5e-47
WP_096803726.1|3249121_3249916_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096803727.1|3249967_3250873_-	cation transporter	NA	NA	NA	NA	NA
WP_096803728.1|3250869_3251256_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.5	4.0e-08
WP_096804386.1|3251331_3252417_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_096803729.1|3252420_3253191_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_096804387.1|3253324_3256009_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9L2Y7	Tupanvirus	37.1	4.6e-159
WP_096803730.1|3256111_3257344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096803731.1|3257460_3257937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803732.1|3257947_3259735_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.0	5.3e-10
WP_096803733.1|3259731_3261081_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_096803734.1|3261312_3262332_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_096803735.1|3263082_3263607_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_096803736.1|3263660_3264776_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_096803737.1|3264772_3265774_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_172895808.1|3265770_3269067_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_096803740.1|3269079_3269427_-	chorismate mutase	NA	NA	NA	NA	NA
WP_096803741.1|3269423_3270764_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.7	2.7e-136
WP_157773593.1|3271007_3271670_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.1	2.9e-38
WP_172895892.1|3271743_3272319_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	51.1	1.4e-44
WP_096803744.1|3272741_3273575_+	C40 family peptidase	NA	A0A2P1CIC9	Actinomyces_phage	39.6	7.7e-12
WP_096803745.1|3273629_3274223_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_096803746.1|3274352_3275918_-	trigger factor	NA	NA	NA	NA	NA
3276267:3276309	attL	CTTCCAAACTGATTACGCGGGTTCGATTCCCGTCGCCCGCTCC	NA	NA	NA	NA
WP_096803747.1|3276421_3277876_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_096803748.1|3277892_3278462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096804388.1|3279039_3279732_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F2H8	Mycobacterium_phage	46.7	7.9e-47
WP_157773503.1|3279835_3280609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157773504.1|3280671_3281148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803751.1|3281144_3282125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803752.1|3282650_3282965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096803753.1|3282961_3284344_+|integrase	site-specific integrase	integrase	A0A2D1GK59	Mycobacterium_phage	35.5	1.7e-27
3284649:3284691	attR	CTTCCAAACTGATTACGCGGGTTCGATTCCCGTCGCCCGCTCC	NA	NA	NA	NA
