The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	7193	15817	3990106		Mycobacterium_phage(28.57%)	10	NA	NA
WP_006660938.1|7193_8423_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.8	9.6e-104
WP_006662335.1|8577_8841_+	YbeD family protein	NA	NA	NA	NA	NA
WP_179897764.1|8998_9628_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_006660935.1|9698_10664_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_006662336.1|10850_11060_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	2.7e-22
WP_006660933.1|11277_11736_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	43.1	1.0e-18
WP_006662337.1|12033_12261_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	2.8e-17
WP_006660931.1|12272_12707_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	34.1	1.4e-12
WP_006660930.1|12699_14832_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.7	2.3e-206
WP_006660929.1|14845_15817_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.5	3.9e-132
>prophage 2
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	146654	197711	3990106	portal,tail,head,plate,terminase,integrase,holin,capsid	Salmonella_phage(37.14%)	56	164199:164221	197857:197879
WP_006657323.1|146654_148661_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.1	6.3e-20
WP_006657322.1|149064_149517_-	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_006657321.1|149948_150578_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_006657320.1|150580_151348_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_006657319.1|151347_152814_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006662718.1|153171_154053_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_006657317.1|154062_154446_+	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_192941394.1|154499_155729_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.2e-18
WP_006657315.1|155725_157189_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_006657314.1|157280_158084_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_006662721.1|158094_158901_+	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_006657312.1|159053_160424_+	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_006657311.1|160746_161625_+	4-hydroxyphenylacetate catabolism regulatory protein HpaA	NA	NA	NA	NA	NA
WP_006662722.1|162075_163638_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_006657309.1|163657_164176_+	4-hydroxyphenylacetate 3-monooxygenase, reductase component	NA	NA	NA	NA	NA
164199:164221	attL	AGCCCCTATTAAGGGGCTTTTTT	NA	NA	NA	NA
WP_039861398.1|164324_165308_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.2	2.4e-105
WP_006657307.1|165374_165674_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	69.7	2.2e-33
WP_006657306.1|165797_166097_+	regulatory protein	NA	Q1JS60	Enterobacteria_phage	67.0	3.2e-29
WP_006657305.1|166093_166318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657303.1|166492_166912_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_006657302.1|166981_167236_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_006657301.1|167228_167450_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	52.8	3.4e-12
WP_036952264.1|167453_167750_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	46.6	1.6e-09
WP_006657299.1|167862_170655_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	36.8	7.8e-109
WP_006657296.1|171459_172593_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	28.7	7.2e-29
WP_006657295.1|173217_174591_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_006657294.1|174801_175386_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_006657293.1|175565_176465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657292.1|176620_176998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657290.1|177759_178797_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	72.0	2.0e-139
WP_006657289.1|178796_180554_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	75.9	5.9e-272
WP_006657287.1|180710_181538_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	45.6	8.0e-54
WP_006657286.1|181550_182633_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	62.1	4.5e-121
WP_006657285.1|182659_183295_+|terminase	terminase	terminase	V9IQK3	Stenotrophomonas_phage	40.0	4.0e-21
WP_006657284.1|183380_183857_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	40.0	3.2e-23
WP_006657283.1|183853_184057_+|tail	tail protein X	tail	E5E3W5	Burkholderia_phage	57.4	8.0e-16
WP_006657282.1|184063_184366_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	56.8	9.2e-24
WP_006657281.1|184362_184725_+	DUF882 domain-containing protein	NA	A0A0G2SSI0	Proteus_phage	64.9	3.3e-36
WP_006657280.1|184726_185275_+	DUF2570 domain-containing protein	NA	K7PHH7	Enterobacteria_phage	37.5	2.5e-19
WP_006657279.1|185258_185687_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	40.8	6.9e-25
WP_006657278.1|185683_186301_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.6	4.5e-25
WP_006657277.1|186389_186770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036974590.1|186776_187400_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	60.3	3.7e-59
WP_006657275.1|187396_187738_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	57.7	9.7e-30
WP_036974589.1|187740_188652_+|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	64.4	1.3e-102
WP_006657273.1|188644_189256_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	65.8	4.7e-75
WP_006657272.1|189252_190485_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	41.7	8.6e-60
WP_039861394.1|190493_191021_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	45.6	8.8e-30
WP_006657270.1|191137_192310_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	72.9	2.2e-166
WP_006657269.1|192312_192828_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	64.3	1.8e-59
WP_006657268.1|192843_193149_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	55.1	2.6e-18
WP_006657267.1|193163_193283_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	64.1	3.6e-08
WP_006657266.1|193275_195888_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	36.4	2.5e-125
WP_006657265.1|195890_196337_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	57.3	2.2e-42
WP_036952511.1|196333_197419_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	59.2	4.6e-118
WP_006657262.1|197492_197711_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	67.6	5.2e-21
197857:197879	attR	AGCCCCTATTAAGGGGCTTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	1791698	1883495	3990106	portal,tail,head,plate,terminase,tRNA,integrase,protease,holin,lysis,capsid	Proteus_phage(17.02%)	105	1799533:1799557	1847634:1847658
WP_006660125.1|1791698_1792508_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.2	2.5e-15
WP_006660124.1|1792551_1793013_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_006660123.1|1793024_1794230_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	34.7	2.7e-66
WP_006660122.1|1794867_1795809_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_006662981.1|1795836_1796232_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_006660120.1|1796224_1797328_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_006660119.1|1797390_1798146_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.8	1.2e-08
WP_006662984.1|1798190_1799558_-	LOG family protein	NA	NA	NA	NA	NA
1799533:1799557	attL	CCTAATGGACTGATATGAGTAATCA	NA	NA	NA	NA
WP_036978716.1|1799623_1800688_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	44.8	6.0e-86
WP_006660116.1|1800644_1800911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660115.1|1801113_1801308_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	75.0	1.7e-23
WP_006660114.1|1801315_1801861_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.3	1.2e-58
WP_006660113.1|1801850_1802084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096759622.1|1802028_1802373_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	53.5	1.7e-18
WP_036978721.1|1803322_1803838_-	PmgT domain-containing protein	NA	R9VWB9	Serratia_phage	26.9	1.4e-11
WP_080547027.1|1803949_1804522_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	47.3	1.7e-39
WP_006657660.1|1804808_1805264_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	71.3	2.7e-51
WP_006657659.1|1805253_1806060_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	84.2	9.0e-127
WP_006657658.1|1806037_1806871_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	80.5	7.9e-134
WP_006657657.1|1806867_1807035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657655.1|1807162_1807345_-	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	80.0	5.3e-19
WP_006657654.1|1807452_1807677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657653.1|1808147_1808423_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	53.2	2.5e-12
WP_006657652.1|1808622_1808808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657651.1|1808820_1809711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657650.1|1809703_1810276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657649.1|1810316_1810658_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	59.3	2.6e-35
WP_006657647.1|1810667_1811378_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	61.9	4.7e-79
WP_036979806.1|1811473_1811665_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	55.7	2.6e-08
WP_006657646.1|1811820_1812150_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	81.3	3.6e-42
WP_006657645.1|1812170_1812347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036982966.1|1812396_1813260_+	hypothetical protein	NA	G9L680	Escherichia_phage	42.9	1.5e-55
WP_006657643.1|1813262_1814633_+	DNA helicase	NA	K7P852	Enterobacteria_phage	67.0	1.6e-168
WP_006657642.1|1814658_1814832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657641.1|1814841_1815087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657640.1|1815073_1815517_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_071586581.1|1815610_1815793_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_006657638.1|1816017_1816461_+	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	78.1	1.1e-25
WP_006657600.1|1816673_1817132_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	76.2	7.3e-65
WP_006657636.1|1817128_1817413_+	hypothetical protein	NA	A0A088CC23	Shigella_phage	64.2	3.2e-10
WP_006657635.1|1817416_1817812_+	antitermination protein	NA	S5M7R9	Escherichia_phage	50.8	8.0e-28
WP_036962787.1|1818073_1818667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657631.1|1819603_1820272_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006657596.1|1820480_1820786_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036960137.1|1820778_1821264_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	73.7	4.0e-61
WP_036982937.1|1821608_1822079_+|lysis	lysis protein	lysis	I6WLR5	Burkholderia_virus	25.7	3.0e-05
WP_036978696.1|1822256_1822526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657591.1|1824281_1824830_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	77.0	3.8e-52
WP_096759623.1|1824801_1826718_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	62.9	3.5e-246
WP_006660427.1|1826719_1826926_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	45.6	4.8e-08
WP_006660426.1|1826922_1828500_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.3	8.4e-185
WP_117584530.1|1828489_1829971_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.1	8.1e-97
WP_039861752.1|1830005_1830344_+|head	head decoration protein	head	NA	NA	NA	NA
WP_039861751.1|1830370_1831399_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	57.5	1.3e-106
WP_006658547.1|1831444_1831825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658548.1|1831817_1832174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096759624.1|1832177_1832843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660104.1|1832845_1833391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096759625.1|1833368_1834004_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.5	2.1e-14
WP_096759626.1|1834040_1835519_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	37.8	2.4e-77
WP_006660481.1|1835515_1836022_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_036960142.1|1836085_1836385_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_096759627.1|1836487_1838116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080547032.1|1838202_1838595_+|tail	phage tail protein	tail	K4I406	Acidithiobacillus_phage	37.0	8.3e-17
WP_036950008.1|1838569_1838785_+|tail	tail protein X	tail	R9TR63	Vibrio_phage	47.1	1.2e-09
WP_006658380.1|1838788_1839919_+	late control protein D	NA	D4HTW7	Vibrio_phage	36.1	1.5e-34
WP_006658379.1|1839925_1840279_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	51.8	6.9e-23
WP_006658378.1|1840262_1841165_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.7	5.5e-64
WP_006658377.1|1841170_1841713_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	39.0	2.7e-26
WP_006658376.1|1841727_1842855_+|tail	phage tail protein	tail	A0A0M3LS19	Mannheimia_phage	45.7	2.9e-22
WP_006658375.1|1842863_1843391_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	46.2	5.1e-30
WP_096759628.1|1843526_1845260_+	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_117584510.1|1846536_1847379_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	54.0	1.7e-75
WP_006658421.1|1847762_1848608_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	8.8e-40
1847634:1847658	attR	CCTAATGGACTGATATGAGTAATCA	NA	NA	NA	NA
WP_006658420.1|1848763_1849324_+	SecY-interacting protein	NA	NA	NA	NA	NA
WP_006658418.1|1849707_1850604_-	DUF535 family protein	NA	NA	NA	NA	NA
WP_006658417.1|1850852_1851191_+	YqcC family protein	NA	NA	NA	NA	NA
WP_006658416.1|1851194_1851953_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_006658415.1|1851977_1852430_+	flavodoxin	NA	NA	NA	NA	NA
WP_006658414.1|1852514_1852901_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_006658413.1|1853359_1854187_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_006658412.1|1854246_1856886_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_006658411.1|1856991_1857789_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006658410.1|1858465_1859191_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_006658409.1|1859338_1860190_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_006658408.1|1860396_1861125_+	UMP kinase	NA	NA	NA	NA	NA
WP_006658407.1|1861233_1861791_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006658406.1|1861940_1863134_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_006658405.1|1863315_1864068_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	45.9	4.0e-28
WP_006658404.1|1864074_1864941_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006658403.1|1864949_1866302_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_006658402.1|1866343_1868758_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_006658401.1|1868845_1869340_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_006658400.1|1869343_1870381_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_006658399.1|1870510_1870963_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_006658398.1|1870964_1871762_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_006658397.1|1871815_1872970_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_006658396.1|1872969_1873560_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	2.0e-30
WP_039861722.1|1873588_1877071_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.5	6.5e-206
WP_006658394.1|1877083_1878043_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_006658393.1|1878166_1879543_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_006658392.1|1879616_1879880_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_006658391.1|1880192_1880849_+	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006658390.1|1880936_1882655_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036962733.1|1882775_1883495_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	2286942	2302851	3990106		Morganella_phage(29.41%)	28	NA	NA
WP_006658116.1|2286942_2288124_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	68.5	2.2e-150
WP_071586586.1|2288078_2288312_-	excisionase	NA	I6PBM8	Cronobacter_phage	61.8	3.1e-19
WP_080547031.1|2288538_2288721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658117.1|2288812_2289268_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	64.0	1.9e-44
WP_096759635.1|2289257_2290064_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	84.6	1.2e-126
WP_006658119.1|2290041_2290875_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	82.0	9.3e-135
WP_006657620.1|2290871_2291039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657618.1|2291166_2291349_-	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	80.0	5.3e-19
WP_006658121.1|2291456_2291681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658122.1|2291825_2292038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658123.1|2292034_2292253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050788073.1|2292631_2292943_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	61.2	1.0e-22
WP_039861649.1|2293355_2293589_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_006658127.1|2293663_2294419_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_006658128.1|2294415_2294976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658129.1|2295025_2295367_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	60.2	1.4e-36
WP_006658130.1|2295376_2296021_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	63.3	5.8e-76
WP_006658131.1|2296128_2296338_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	78.3	3.3e-25
WP_006658132.1|2296469_2296796_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	79.6	1.9e-43
WP_006658133.1|2296851_2297814_+	replication protein	NA	A0A1P8DTG2	Proteus_phage	49.7	4.5e-72
WP_006658134.1|2297810_2298485_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	74.1	3.4e-95
WP_006658135.1|2298511_2298685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861650.1|2299114_2299564_+	hypothetical protein	NA	A0A2I7R9W3	Vibrio_phage	36.9	3.4e-14
WP_006658139.1|2299776_2300235_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	76.2	1.2e-64
WP_006658140.1|2300231_2300516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658141.1|2300519_2300900_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	69.6	1.3e-46
WP_039861651.1|2301122_2302118_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_006661258.1|2302638_2302851_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	84.3	4.7e-27
>prophage 5
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	2305991	2338916	3990106	lysis,tail,holin	Morganella_phage(23.08%)	39	NA	NA
WP_006658152.1|2305991_2306192_+|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	73.7	1.4e-17
WP_006658153.1|2306172_2306745_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	61.2	7.0e-49
WP_050788072.1|2306827_2307277_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	54.7	6.8e-31
WP_006658155.1|2307390_2307603_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_006658156.1|2308451_2308685_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_006658157.1|2308871_2309003_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_006658158.1|2309473_2309989_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	80.1	7.6e-79
WP_006658160.1|2310457_2311060_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	5.3e-63
WP_006658161.1|2311062_2312550_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.4	3.2e-263
WP_006658162.1|2312549_2313920_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.8	4.6e-123
WP_096759636.1|2313916_2315038_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.4	7.9e-105
WP_039861876.1|2315150_2315927_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	58.0	2.1e-64
WP_006659253.1|2315940_2316906_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	1.2e-125
WP_006659252.1|2316989_2317472_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	45.3	3.3e-31
WP_006659251.1|2317474_2317825_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	44.2	1.2e-19
WP_006659250.1|2317826_2318405_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	56.1	1.2e-51
WP_006659249.1|2318405_2318807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006659248.1|2318819_2319509_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	57.3	5.1e-62
WP_006659247.1|2319542_2319845_+	hypothetical protein	NA	A0A0H5AUF4	Pseudomonas_phage	37.6	1.9e-08
WP_006659246.1|2319862_2320144_+	DUF1799 domain-containing protein	NA	F8UBV2	Escherichia_phage	54.1	1.5e-12
WP_006659245.1|2320591_2321005_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	73.9	1.6e-50
WP_006659244.1|2321004_2322267_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	79.5	6.0e-194
WP_006659243.1|2322595_2323120_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_036975041.1|2323509_2323971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006659240.1|2324242_2324989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006659239.1|2325098_2325458_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_006659238.1|2325546_2325993_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_006659237.1|2326147_2329093_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	32.9	3.8e-130
WP_006659236.1|2329125_2329338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006659235.1|2329400_2329745_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	39.8	5.9e-19
WP_006659234.1|2329741_2330485_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	57.8	2.3e-84
WP_036960323.1|2330481_2331192_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	64.8	5.8e-85
WP_006658704.1|2331188_2331794_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.0	3.9e-58
WP_006658703.1|2331854_2335517_+	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	50.6	0.0e+00
WP_006658701.1|2335844_2336144_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_036966831.1|2336376_2336616_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	37.3	5.8e-05
WP_006658699.1|2336682_2336952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658698.1|2337374_2337587_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006658697.1|2338433_2338916_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.8e-29
>prophage 6
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	2580943	2621743	3990106	head,plate,terminase,integrase,lysis	Bacteriophage(19.44%)	50	2580756:2580785	2621920:2621949
2580756:2580785	attL	ACTCCGGTAGCCGGCACCAAATAAGAACCC	NA	NA	NA	NA
WP_006660316.1|2580943_2582113_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	47.7	6.1e-108
WP_006660317.1|2582109_2582307_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_006660318.1|2582316_2582598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660319.1|2582602_2583994_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	79.3	3.3e-225
WP_006660321.1|2584997_2585267_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	76.4	6.6e-34
WP_006660322.1|2585250_2585478_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006660323.1|2585584_2585776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660324.1|2585847_2587905_-	DNA polymerase	NA	Q775A3	Bordetella_phage	65.2	6.5e-262
WP_006660325.1|2587927_2588494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660326.1|2588485_2589037_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	69.4	1.8e-65
WP_006660327.1|2589052_2590339_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	63.4	1.9e-155
WP_006660328.1|2590339_2591095_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	39.4	4.0e-28
WP_006660330.1|2591267_2591888_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	46.6	1.1e-42
WP_036982262.1|2592216_2592708_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	43.0	6.3e-30
WP_006660332.1|2593074_2593749_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	50.2	6.7e-59
WP_006660333.1|2593886_2594087_+	transcriptional regulator	NA	K7ST61	Bacteriophage	46.6	1.8e-07
WP_006660334.1|2594090_2596349_+	ATPase	NA	Q9T1U5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	70.9	0.0e+00
WP_006660335.1|2596612_2597044_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	42.1	9.1e-17
WP_006660336.1|2597373_2597694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036982277.1|2597730_2598048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660339.1|2598515_2598785_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	65.6	1.3e-24
WP_006660340.1|2598784_2599255_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.2	1.9e-47
WP_117584524.1|2599430_2599880_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	42.6	2.9e-13
WP_006660344.1|2599957_2600509_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	62.5	6.7e-57
WP_006660345.1|2600501_2601737_+|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	72.2	1.2e-178
WP_006660346.1|2601741_2603259_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	45.3	4.8e-105
WP_006660347.1|2603281_2603995_+|head	head protein	head	A0A088C492	Shewanella_sp._phage	38.7	9.1e-38
WP_006660348.1|2603991_2605248_+	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	45.6	2.7e-37
WP_039862215.1|2605247_2605745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660350.1|2605744_2606812_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.6	7.9e-54
WP_006660351.1|2606867_2607209_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.8	2.1e-08
WP_080547044.1|2607211_2607643_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	34.5	2.0e-11
WP_006660353.1|2607642_2608101_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	35.6	7.4e-09
WP_006660354.1|2608100_2608469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660355.1|2608458_2608974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660356.1|2608983_2610471_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.4	2.4e-80
WP_006660357.1|2610481_2610934_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.9	8.0e-24
WP_006660358.1|2610983_2611442_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	50.3	1.9e-25
WP_117584525.1|2611524_2613657_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.1	3.5e-16
WP_006660360.1|2613653_2614181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660361.1|2614183_2614477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660362.1|2614469_2615285_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	38.6	2.8e-43
WP_006660363.1|2615327_2616020_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	39.4	6.1e-31
WP_006660364.1|2616016_2616361_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	33.9	1.6e-11
WP_006660365.1|2616353_2617541_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.9	5.1e-78
WP_006660366.1|2617537_2618197_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.7	4.0e-40
WP_006660367.1|2618202_2619501_+	hypothetical protein	NA	A0A0H3UDV7	Escherichia_phage	37.7	1.4e-28
WP_006660368.1|2619531_2621070_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_006660369.1|2621192_2621501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039862222.1|2621497_2621743_-	DinI-like family protein	NA	Q6K1F1	Salmonella_virus	32.5	1.4e-06
2621920:2621949	attR	ACTCCGGTAGCCGGCACCAAATAAGAACCC	NA	NA	NA	NA
>prophage 7
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	2751612	2839148	3990106	portal,tail,head,terminase,tRNA,integrase,protease,holin	Cronobacter_phage(14.55%)	110	2744710:2744726	2853108:2853124
2744710:2744726	attL	AGCATGGACAAACTCTT	NA	NA	NA	NA
WP_039862435.1|2751612_2752734_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_006660843.1|2752817_2753267_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_050788092.1|2753259_2753901_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_039862415.1|2754548_2755802_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	6.7e-20
WP_006660847.1|2755924_2757058_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.0	1.9e-151
WP_039862418.1|2757032_2757284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660849.1|2757283_2757490_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	46.7	5.9e-06
WP_006660851.1|2757732_2757900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660852.1|2757893_2758487_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_006660853.1|2758483_2758714_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	59.7	2.7e-12
WP_006660854.1|2758739_2758919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006660855.1|2758963_2759464_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.9	4.3e-42
WP_006660856.1|2759463_2761470_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.6	3.6e-124
WP_006660857.1|2761482_2761815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039862436.1|2762279_2763032_-	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	36.4	7.6e-27
WP_006660859.1|2763135_2763384_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006660860.1|2763431_2763887_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.7	9.2e-28
WP_006660861.1|2763904_2764129_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	1.2e-15
WP_006660862.1|2764130_2764982_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	62.7	1.4e-32
WP_006660863.1|2764974_2765565_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.4e-44
WP_006660864.1|2765561_2766932_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	46.0	3.6e-99
WP_039862423.1|2766952_2767126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660866.1|2767478_2767649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660867.1|2767676_2768018_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.1	6.5e-34
WP_006660868.1|2768045_2768696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660869.1|2768921_2769515_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	59.2	9.5e-65
WP_006660870.1|2769529_2770393_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	48.6	5.4e-85
WP_006660871.1|2770404_2770719_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	1.9e-32
WP_006660872.1|2770753_2771305_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	45.5	5.7e-32
WP_006660873.1|2771496_2771727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660874.1|2771811_2772225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660875.1|2772224_2772593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660876.1|2772589_2773072_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	76.9	3.7e-67
WP_006660877.1|2773073_2773613_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	53.6	6.9e-30
WP_006660878.1|2773674_2774661_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.2	9.3e-33
WP_006660879.1|2774638_2775949_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.4	1.9e-150
WP_192941399.1|2777301_2778423_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	49.2	6.1e-97
WP_006660882.1|2778538_2779315_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	55.8	1.1e-60
WP_006660883.1|2779327_2780287_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.0	2.2e-132
WP_006660884.1|2780325_2780808_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	48.0	4.3e-31
WP_006660885.1|2780810_2781164_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	43.0	5.5e-20
WP_192941400.1|2781180_2781747_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.9	1.4e-49
WP_006660887.1|2781743_2782145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006660888.1|2782157_2782847_+	hypothetical protein	NA	G8C7Q3	Escherichia_phage	56.4	2.1e-60
WP_006660889.1|2782879_2783185_+	hypothetical protein	NA	A0A0H5AUF4	Pseudomonas_phage	36.5	9.3e-08
WP_006660890.1|2783202_2783487_+	DUF1799 domain-containing protein	NA	K4FJF8	Escherichia_phage	46.3	1.1e-10
WP_131657922.1|2783568_2784153_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	58.9	5.7e-22
WP_096759639.1|2784214_2787151_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.1	2.2e-130
WP_096759640.1|2787189_2787534_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	46.4	1.8e-23
WP_006660112.1|2787530_2788274_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	58.0	1.2e-85
WP_096759641.1|2788270_2788981_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	65.2	2.0e-85
WP_006659404.1|2788977_2789580_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.1	5.1e-58
WP_096759642.1|2789635_2792941_+	host specificity protein J	NA	A0A1P8DTI4	Proteus_phage	53.0	0.0e+00
WP_006659401.1|2792937_2793954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096759643.1|2794019_2795537_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	33.9	1.8e-35
WP_006658983.1|2795691_2795844_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	7.6e-19
WP_006658982.1|2796018_2797305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658981.1|2797301_2798429_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	62.0	2.1e-129
WP_154609795.1|2798409_2798652_-	excisionase	NA	NA	NA	NA	NA
WP_006658978.1|2799121_2799637_+	hypothetical protein	NA	U5P0A0	Shigella_phage	48.1	7.5e-26
WP_006658977.1|2799633_2799960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658976.1|2799956_2800334_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	52.3	1.3e-30
WP_006658975.1|2800347_2800890_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	65.5	1.1e-43
WP_039861822.1|2800901_2801609_+	antitermination protein	NA	F1C595	Cronobacter_phage	48.7	1.1e-56
WP_006658973.1|2801709_2802057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658972.1|2802041_2802824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658971.1|2802827_2803397_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_006658970.1|2803817_2804321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658969.1|2804462_2804639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861821.1|2804723_2805281_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	37.0	4.0e-25
WP_039861820.1|2805301_2805511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658966.1|2805570_2805774_+|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	73.3	1.0e-18
WP_006658965.1|2805754_2806324_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.7	4.7e-53
WP_006658964.1|2806382_2806760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050788079.1|2806975_2807431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658961.1|2807764_2808193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039861819.1|2808618_2808972_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	82.8	4.5e-54
WP_006658959.1|2809127_2809601_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	79.6	1.5e-68
WP_006658958.1|2809623_2811312_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	85.2	1.1e-294
WP_006658957.1|2811308_2811470_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	71.7	3.2e-15
WP_006658956.1|2811459_2812683_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.3	5.4e-208
WP_117584512.1|2812682_2812919_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	77.3	6.7e-22
WP_006658954.1|2813789_2814407_-	hydrolase	NA	NA	NA	NA	NA
WP_006658953.1|2815123_2815573_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_006658951.1|2816049_2816808_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_006658950.1|2816894_2817275_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_006658948.1|2817999_2818389_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006658947.1|2818453_2819296_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_036961450.1|2819503_2819842_+	GlpM family protein	NA	NA	NA	NA	NA
WP_006658945.1|2820006_2820402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861818.1|2820453_2821233_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006658943.1|2821463_2821808_+	DMT family protein	NA	NA	NA	NA	NA
WP_006658942.1|2821861_2823013_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X7QHI1	Faustovirus	25.1	4.6e-15
WP_039861817.1|2823291_2823801_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_006658940.1|2823859_2824213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658939.1|2824559_2824931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658938.1|2825218_2825467_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_036961359.1|2826124_2827582_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006661580.1|2827757_2828642_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_006658935.1|2828643_2829105_-	DMT family transporter	NA	NA	NA	NA	NA
WP_039861816.1|2829109_2829562_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006658933.1|2829660_2830617_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006658932.1|2830657_2831989_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_006658931.1|2832210_2833020_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_006658930.1|2833180_2833564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006661584.1|2833813_2833954_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_006658927.1|2834140_2835505_+	amino acid permease	NA	NA	NA	NA	NA
WP_006658925.1|2835608_2836184_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_006658924.1|2836637_2837435_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_006661587.1|2837771_2839148_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	83.0	1.9e-180
2853108:2853124	attR	AGCATGGACAAACTCTT	NA	NA	NA	NA
>prophage 8
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	2904147	2935783	3990106	terminase,tail,integrase	Enterobacter_phage(24.0%)	41	2902691:2902705	2923457:2923471
2902691:2902705	attL	GAAATTCTTGAAGAT	NA	NA	NA	NA
WP_039861811.1|2904147_2905353_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	60.5	9.7e-133
WP_006658862.1|2905358_2905544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658861.1|2905536_2906190_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	64.7	4.8e-78
WP_006658859.1|2906372_2906612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658857.1|2906765_2907050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039861810.1|2907049_2907337_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.0	8.2e-14
WP_039861809.1|2907339_2907564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658854.1|2907604_2907943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658853.1|2907981_2908266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039861808.1|2908303_2909365_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	49.5	1.7e-96
WP_006658851.1|2909420_2910848_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	44.4	7.0e-98
WP_006658850.1|2910825_2910984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006658849.1|2911314_2911914_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	29.3	1.0e-18
WP_006658847.1|2912418_2912622_+	hypothetical protein	NA	R9UB09	Vibrio_phage	52.0	9.5e-09
WP_039861830.1|2912667_2913597_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	55.5	2.8e-63
WP_006658845.1|2913565_2914039_+	replication protein	NA	NA	NA	NA	NA
WP_006658844.1|2914255_2914681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658843.1|2914677_2915040_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	66.7	1.4e-39
WP_096759645.1|2915120_2915378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138223801.1|2915478_2915796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658840.1|2915799_2916033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658838.1|2916211_2916484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861807.1|2916503_2917163_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	61.0	5.4e-77
WP_006658836.1|2917235_2917577_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.0	1.4e-33
WP_039861806.1|2917606_2918206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861805.1|2918244_2918811_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	47.1	3.8e-39
WP_006658833.1|2918807_2920289_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	76.7	1.1e-231
WP_006658832.1|2920474_2920690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006658831.1|2920705_2922358_+|tail	tail protein	tail	A0A193GYI4	Enterobacter_phage	68.1	6.5e-204
WP_006658830.1|2922354_2922678_+	hypothetical protein	NA	Q2A090	Sodalis_phage	54.9	3.3e-19
WP_006658829.1|2922674_2923346_+	hypothetical protein	NA	A0A193GYS7	Enterobacter_phage	63.5	1.2e-44
WP_006658828.1|2923363_2924347_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	63.2	4.6e-117
2923457:2923471	attR	GAAATTCTTGAAGAT	NA	NA	NA	NA
WP_006658827.1|2924404_2924836_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	52.1	6.7e-28
WP_006658826.1|2924844_2925186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039861804.1|2925237_2925549_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	44.9	3.6e-15
WP_006658824.1|2925548_2926154_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	2.1e-67
WP_006658823.1|2926153_2928610_+	hypothetical protein	NA	Q858G3	Salmonella_phage	69.2	0.0e+00
WP_006658822.1|2928593_2929082_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	58.9	1.0e-48
WP_006658821.1|2929081_2929657_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.3	1.7e-47
WP_006658820.1|2929670_2932412_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.8	2.0e-117
WP_006658819.1|2932414_2935783_+	hypothetical protein	NA	A0A2I7R904	Vibrio_phage	34.4	4.3e-178
>prophage 9
NZ_CP023536	Providencia alcalifaciens strain FDAARGOS_408 chromosome, complete genome	3990106	3696149	3789419	3990106	portal,tail,head,terminase,tRNA,integrase,protease,holin,lysis,capsid	Morganella_phage(30.91%)	98	3710460:3710477	3789624:3789641
WP_006657818.1|3696149_3696938_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_006657817.1|3697121_3697928_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_006657816.1|3697992_3698739_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006657815.1|3698743_3698923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657814.1|3699066_3699282_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_006657813.1|3699734_3700709_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006657812.1|3700701_3702450_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.4	3.2e-60
WP_006657811.1|3702497_3704804_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_006657810.1|3705080_3705368_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.1	4.9e-11
WP_006662163.1|3705422_3707096_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_006657808.1|3707269_3707953_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_006657807.1|3708143_3709421_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006657806.1|3709526_3710615_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.1	8.3e-83
3710460:3710477	attL	TTCTTTTGCCACTTCAAT	NA	NA	NA	NA
WP_006657804.1|3710908_3712543_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_006662166.1|3712599_3713151_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_006657801.1|3713374_3714151_+	esterase	NA	NA	NA	NA	NA
WP_006657800.1|3714361_3716449_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.6	3.4e-40
WP_039861572.1|3716466_3717795_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006657798.1|3717798_3719889_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.3	1.2e-42
WP_006657797.1|3720062_3720356_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_006657796.1|3720509_3721037_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_006657795.1|3721269_3721716_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_117584501.1|3722150_3722672_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_006657793.1|3722853_3723897_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_006657792.1|3724132_3725887_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006657790.1|3726219_3727077_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006657789.1|3727165_3729448_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.5e-158
WP_036965509.1|3729596_3730355_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	2.2e-18
WP_006657787.1|3730553_3731384_+	membrane protein	NA	NA	NA	NA	NA
WP_006657786.1|3731545_3732838_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	2.3e-95
WP_006657785.1|3732943_3734287_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	4.3e-81
WP_006657784.1|3734311_3734932_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_006657783.1|3735018_3738678_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.9	3.3e-91
WP_004918089.1|3739090_3739585_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006657782.1|3740121_3741084_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.4	6.2e-66
WP_096759660.1|3741274_3742954_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_006657778.1|3743273_3745040_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	29.9	2.7e-14
WP_006657777.1|3745042_3746785_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.5	2.4e-23
WP_006657776.1|3746793_3747516_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244560.1|3747655_3747874_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_006657775.1|3747941_3750227_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	6.5e-170
WP_006657774.1|3750258_3750579_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	51.2	1.3e-15
WP_006657773.1|3751203_3751485_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	44.6	1.2e-12
WP_039861594.1|3751518_3751998_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_006657771.1|3752010_3752190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657769.1|3752812_3753037_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	NA	NA	NA	NA
WP_006657767.1|3753354_3757017_-	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	47.7	0.0e+00
WP_006657766.1|3757072_3757678_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.6	6.3e-56
WP_006657765.1|3757674_3758385_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	65.6	1.2e-87
WP_006657764.1|3758381_3759125_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	55.8	1.4e-81
WP_006657763.1|3759121_3759457_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	58.3	8.3e-34
WP_006657762.1|3759458_3762740_-|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	55.3	1.8e-274
WP_006657761.1|3762760_3763051_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	89.2	5.7e-39
WP_006657760.1|3763062_3763440_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	80.0	1.6e-49
WP_006657759.1|3763443_3763911_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	90.3	2.0e-73
WP_006657758.1|3763971_3764307_-	DUF3168 domain-containing protein	NA	A0A1W6JP05	Morganella_phage	65.8	3.4e-35
WP_006657757.1|3764306_3764753_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	66.7	1.1e-46
WP_006657756.1|3764745_3765069_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	72.0	5.7e-40
WP_006657755.1|3765077_3765380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	68.0	2.2e-33
WP_039861593.1|3765468_3766701_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	78.0	1.0e-177
WP_192941392.1|3766716_3767373_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.5	5.9e-84
WP_006657752.1|3767311_3768544_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	84.9	1.0e-206
WP_006657751.1|3768545_3768695_-	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	66.7	1.1e-11
WP_006657750.1|3768691_3770422_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	82.2	8.1e-290
WP_006657749.1|3770418_3770913_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	76.2	4.5e-68
WP_039861567.1|3771085_3771439_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	81.0	1.9e-52
WP_165480216.1|3771815_3772013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657743.1|3772435_3772891_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	57.1	1.2e-35
WP_006657742.1|3772892_3773378_-	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	71.3	5.7e-60
WP_006657741.1|3773370_3773676_-|holin	holin	holin	NA	NA	NA	NA
WP_039861566.1|3774394_3775216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657739.1|3775239_3775725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657738.1|3775749_3776097_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	73.6	2.6e-46
WP_006657737.1|3776129_3776669_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	65.2	4.6e-42
WP_006657736.1|3776665_3777040_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	54.2	6.4e-27
WP_006657735.1|3777024_3777429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657734.1|3777421_3777604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657733.1|3777600_3778056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657732.1|3778052_3778586_-	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	64.1	5.2e-62
WP_006657731.1|3778585_3778831_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	35.0	3.5e-05
WP_006657730.1|3778827_3779889_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	50.4	1.3e-27
WP_192941393.1|3779888_3780068_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_006657728.1|3780057_3780234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039861565.1|3780316_3780775_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	58.3	3.2e-44
WP_006657726.1|3780789_3781452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006657725.1|3781502_3781724_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	66.2	1.2e-20
WP_006657724.1|3781765_3782428_+	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	61.9	3.0e-19
WP_006657723.1|3782778_3783009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657722.1|3783039_3783225_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	1.1e-11
WP_006657721.1|3783369_3784272_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	52.2	6.4e-81
WP_006657720.1|3784355_3785120_+	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	34.0	3.7e-37
WP_006657719.1|3785137_3785341_+	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	44.2	9.8e-06
WP_039861564.1|3785351_3785690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657716.1|3786177_3786723_+	hypothetical protein	NA	A0A2I7RIF7	Vibrio_phage	32.0	2.1e-10
WP_006657715.1|3786709_3787507_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	47.2	3.0e-66
WP_006662242.1|3787538_3787775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006657713.1|3787764_3788898_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	65.7	2.9e-139
WP_006657712.1|3789188_3789419_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.0e-14
3789624:3789641	attR	TTCTTTTGCCACTTCAAT	NA	NA	NA	NA
