The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	213340	220480	5311821		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|213340_213979_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|213975_215238_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|215234_216143_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|216338_217106_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141316.1|217156_217813_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|217918_220480_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	557283	614239	5311821	protease,transposase,portal,terminase,head,integrase	Enterobacteria_phage(41.03%)	57	579813:579829	617493:617509
WP_000019460.1|557283_558264_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
WP_001295458.1|558898_559633_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|559647_561345_-	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_000785931.1|561721_562960_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|563024_563096_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|563451_564372_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000639885.1|564724_564967_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867637.1|565043_565319_-	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000825604.1|565614_566247_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106759.1|566759_568010_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_001283505.1|568063_569758_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	2.3e-23
WP_000955028.1|569827_570772_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|570845_571991_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001307321.1|572046_575640_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_000991370.1|575644_576259_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_000435167.1|576674_577838_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|577837_579376_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000426433.1|579483_580812_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
579813:579829	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000012197.1|581197_582274_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000194515.1|582281_583715_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|583930_584845_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|584916_586164_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|586693_586894_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|587025_587205_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_000208008.1|587301_587931_-	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_000951713.1|587927_588137_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000034245.1|588499_589171_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_001214454.1|589167_589335_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_032159494.1|589331_589613_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001111297.1|589632_589929_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_000951329.1|589952_590336_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_000031367.1|590335_590941_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|590951_591122_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|591197_591350_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|591334_591466_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000807788.1|592512_592755_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|592757_593198_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000200769.1|593194_594607_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000852331.1|594609_596736_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.2	0.0e+00
WP_000426730.1|596749_597634_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_001133485.1|597645_598917_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000375637.1|598959_599145_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246749.1|599119_599602_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_001122379.1|599610_601029_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000785547.1|601028_601877_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_000614045.1|601876_602332_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000964882.1|602334_603027_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246924.1|603036_604503_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_001387755.1|604502_606347_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000749286.1|606361_606847_-	lipoprotein	NA	NA	NA	NA	NA
WP_000820795.1|606872_607187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283829.1|607183_607435_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000865490.1|607540_607681_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835342.1|607913_608792_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000129924.1|608892_610872_+|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000178979.1|610942_612853_-	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000958672.1|613081_614239_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
617493:617509	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	848041	857483	5311821		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|848041_848968_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|848972_849704_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|849684_849792_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|849851_850583_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|850804_852490_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|852486_853206_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|853252_853723_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|853763_854225_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|854349_856350_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|856346_857483_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	1148839	1249828	5311821	holin,protease,lysis,transposase,terminase,tRNA,head,tail,capsid	Enterobacteria_phage(43.28%)	109	NA	NA
WP_001025327.1|1148839_1150573_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|1150788_1151355_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|1151368_1152115_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|1152502_1153603_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|1153627_1156057_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000399648.1|1156326_1157307_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|1157500_1158472_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1158468_1159212_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1159252_1159648_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_044713004.1|1159700_1160471_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|1160452_1161763_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|1161818_1162055_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|1162063_1162210_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|1162213_1162456_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|1162540_1163299_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|1163812_1164361_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476207.1|1164357_1164597_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|1164589_1164793_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|1164789_1165152_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|1165142_1165679_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|1165806_1166631_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|1166696_1167059_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|1167761_1168454_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|1168551_1168812_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|1168804_1169362_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|1169358_1170504_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|1170500_1170725_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|1170721_1171540_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|1171536_1172031_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|1172030_1172684_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|1172680_1173007_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|1173003_1173399_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|1173561_1174377_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|1174384_1175374_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001205470.1|1175391_1175748_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|1175727_1176942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|1176944_1178120_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000917745.1|1178386_1178584_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
WP_000301785.1|1178718_1179432_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874454.1|1180198_1182160_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000142785.1|1182295_1182490_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001289722.1|1182515_1182785_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284510.1|1182860_1183076_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731267.1|1183080_1183425_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_001092883.1|1183475_1184009_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001082546.1|1184307_1184775_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|1185125_1185266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015674556.1|1185398_1185584_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000867568.1|1185978_1186527_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|1186498_1188427_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|1188410_1188617_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001254006.1|1190194_1191700_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256796.1|1191736_1192084_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522645.1|1192141_1193170_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_001204567.1|1193582_1193936_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975015.1|1193951_1194530_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_000683112.1|1194526_1194922_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001401350.1|1194929_1195670_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479153.1|1195685_1196108_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459468.1|1196089_1196524_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000840228.1|1196516_1199078_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_001152493.1|1199402_1200101_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000194780.1|1200105_1200849_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1200785_1201418_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515636.1|1201478_1204958_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001580506.1|1205025_1205625_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000216489.1|1205776_1208947_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_000885566.1|1208946_1209531_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_001217553.1|1209646_1209895_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|1210249_1210816_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|1211125_1212898_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077221229.1|1212890_1213343_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|1213371_1214112_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1214146_1214668_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|1214669_1215272_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|1215342_1215408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1215546_1216158_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1216166_1217177_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|1217323_1218109_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1218105_1218861_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|1218939_1219872_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1219887_1221210_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|1221329_1222301_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091176.1|1222431_1223874_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|1224001_1224871_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|1225208_1226684_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069467.1|1226918_1228730_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|1228766_1229408_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173474.1|1229463_1230642_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|1230775_1231066_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|1231132_1231489_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|1231815_1232475_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936951.1|1232683_1234744_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|1234740_1235403_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|1235426_1236083_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1236184_1236415_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1236553_1236928_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1236931_1237804_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|1237816_1238158_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|1238553_1239210_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|1239210_1239402_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1239506_1239743_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|1239860_1241300_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|1241379_1244013_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|1243981_1245265_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1245394_1245892_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|1245988_1246687_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|1246706_1248755_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1248946_1249828_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	1319204	1408308	5311821	holin,transposase,portal,terminase,tRNA,head,tail,capsid,integrase,plate	Enterobacteria_phage(73.08%)	103	1312444:1312460	1407500:1407516
1312444:1312460	attL	TCTTCCGGCGTCATATC	NA	NA	NA	NA
WP_000019440.1|1319204_1320185_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000373043.1|1320987_1322331_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085233.1|1322566_1322839_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781892.1|1322804_1323212_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001307237.1|1323298_1323919_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001351355.1|1323927_1325235_-	thiosulfate sulfurtransferase YnjE	NA	NA	NA	NA	NA
WP_000882826.1|1325301_1325955_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
WP_000258524.1|1325954_1327490_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001215298.1|1327462_1328629_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000524080.1|1328638_1329187_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977124.1|1329186_1329894_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000077942.1|1329907_1330585_-	protein YdjY	NA	NA	NA	NA	NA
WP_001351354.1|1330589_1331300_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673924.1|1331466_1332273_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000082041.1|1332718_1333939_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
WP_000989416.1|1333935_1334970_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000177212.1|1334966_1336445_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000995007.1|1336441_1337785_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368485.1|1337777_1338746_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228991.1|1339075_1339561_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_001351353.1|1339763_1340339_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252388.1|1340298_1341186_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175037.1|1341415_1342243_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
WP_001039044.1|1342444_1342783_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|1343081_1343402_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000073041.1|1343486_1344845_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000968911.1|1344895_1345246_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000983653.1|1345253_1346096_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000078722.1|1346200_1347553_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000440450.1|1347565_1348324_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000077825.1|1348370_1350632_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
WP_001241561.1|1350814_1351078_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_001326040.1|1351354_1351723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183004.1|1351732_1352170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010722.1|1352173_1353565_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|1353697_1354288_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|1354450_1355119_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|1355265_1355802_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267645.1|1355842_1356703_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|1356808_1357099_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|1357199_1358129_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|1358415_1359174_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|1359226_1359334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144190.1|1361931_1363860_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|1363863_1364406_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1364502_1364700_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1364752_1365109_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1365231_1365276_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|1365558_1366542_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|1366556_1368944_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1368948_1369248_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|1369549_1369690_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|1369880_1370141_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000965749.1|1370460_1371543_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|1371634_1372744_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000005414.1|1372901_1374086_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|1374085_1374598_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|1374652_1375018_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000333498.1|1375026_1375182_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_001390260.1|1375168_1377976_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|1377988_1378477_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|1378633_1379206_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|1379249_1379828_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000108557.1|1379827_1381960_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000071739.1|1381962_1382493_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111965.1|1382485_1383382_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_001067548.1|1383385_1383715_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001342219.1|1383732_1384299_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_000356370.1|1384310_1384946_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000921128.1|1384938_1385406_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|1385429_1387310_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|1387448_1387856_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|1387852_1388245_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000104350.1|1388241_1388565_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|1388567_1388768_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|1388767_1389262_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|1389363_1390164_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|1390209_1391262_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262665.1|1391285_1392122_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_000613796.1|1392276_1394028_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1394027_1395074_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000224219.1|1395585_1395849_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000201251.1|1395850_1396282_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000211292.1|1396301_1396616_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686540.1|1396620_1397580_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_001272076.1|1397656_1400497_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000564228.1|1400493_1400883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847544.1|1400879_1401497_-	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000104300.1|1401508_1401808_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153687.1|1401804_1402050_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000985715.1|1402046_1402250_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_001038613.1|1402239_1402560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021658.1|1402648_1402762_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_000514277.1|1402758_1403001_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159452.1|1403012_1403300_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000917807.1|1403310_1403649_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000163908.1|1403663_1403942_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|1404033_1404345_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247218.1|1404433_1405369_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000416308.1|1405379_1405775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956518.1|1405964_1406945_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|1407007_1407559_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
1407500:1407516	attR	GATATGACGCCGGAAGA	NA	NA	NA	NA
WP_000029466.1|1407558_1408308_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 6
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	1528052	1602685	5311821	holin,protease,lysis,portal,terminase,tail,capsid,integrase	Escherichia_phage(42.86%)	86	1532156:1532173	1560206:1560223
WP_001260841.1|1528052_1528874_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1528973_1529057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1529149_1529485_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|1529881_1531135_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|1531241_1532135_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1532156:1532173	attL	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|1532269_1533490_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1533614_1534310_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|1534325_1535555_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1535713_1536328_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1536370_1537225_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001387389.1|1537818_1538982_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000497813.1|1539243_1539495_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000186868.1|1539542_1540223_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000100829.1|1540219_1541005_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|1541010_1541307_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271588.1|1541303_1543376_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000660961.1|1543483_1543870_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|1543953_1544175_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189936.1|1544631_1544841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005963.1|1544809_1545169_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000211196.1|1545200_1545914_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_000198438.1|1545917_1546301_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000528776.1|1546795_1547572_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|1547559_1548102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274758.1|1548148_1548862_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|1548962_1549163_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000438525.1|1549301_1549598_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000438870.1|1549612_1549831_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390256.1|1549851_1550934_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000790392.1|1550940_1551681_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|1551706_1552477_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|1552492_1552888_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|1552944_1553529_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|1553644_1553749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|1553937_1554150_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|1554359_1554539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|1554557_1555043_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|1555093_1555411_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000211990.1|1556117_1556789_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_001076834.1|1556843_1557254_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254268.1|1557250_1557442_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002252.1|1557465_1557756_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|1557752_1558115_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|1558114_1558309_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|1558301_1558736_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|1559501_1561412_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
1560206:1560223	attR	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142783.1|1561550_1561733_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290236.1|1561758_1562004_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284506.1|1562080_1562296_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|1562300_1562834_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|1563054_1563168_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082713.1|1563169_1563628_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000934362.1|1563708_1564290_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|1564892_1565708_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|1565688_1567395_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_000787512.1|1567394_1569539_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_000344999.1|1569696_1570704_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000214480.1|1570726_1571941_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_001140435.1|1571995_1572385_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290749.1|1572435_1572897_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_000829400.1|1572880_1573444_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207910.1|1573443_1574094_+	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000117962.1|1574090_1575998_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000537686.1|1576080_1576626_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|1576638_1576866_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146337.1|1577206_1578832_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000038927.1|1578828_1580097_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_000455633.1|1580111_1580390_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001390575.1|1580395_1581013_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000836186.1|1581092_1581830_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_000078908.1|1582064_1582205_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_001387532.1|1582261_1582663_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000509022.1|1582754_1583411_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_000455643.1|1583413_1583860_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000540395.1|1583869_1584121_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000012439.1|1584131_1585397_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000331660.1|1585465_1593817_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000481378.1|1593940_1594216_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000628768.1|1594217_1594721_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_001290012.1|1595234_1596071_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000020909.1|1596057_1596342_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_000763355.1|1596338_1596560_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000184488.1|1596607_1597243_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000213043.1|1597650_1597764_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001342404.1|1597774_1600198_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|1600258_1602685_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 7
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	1891732	1953201	5311821	protease,portal,terminase,head,tail,capsid,integrase	Enterobacteria_phage(43.14%)	73	1936433:1936447	1957372:1957386
WP_000422045.1|1891732_1892782_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|1893001_1893760_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|1893756_1894347_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1894386_1895259_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1895359_1895980_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1895976_1896858_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|1896995_1897040_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|1897131_1898694_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1898693_1900289_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|1900289_1901651_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|1901662_1902856_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|1902855_1903662_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1904042_1904222_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1904307_1904808_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1904853_1905360_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|1905848_1906019_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000926528.1|1906133_1906403_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|1906459_1907128_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|1907182_1907767_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216502.1|1907766_1910601_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_001228314.1|1910752_1911352_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|1911419_1914899_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|1914965_1915304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|1915377_1915980_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|1915916_1916660_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|1916664_1917363_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|1917362_1917692_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082359.1|1917688_1920262_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|1920242_1920656_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|1920682_1921114_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|1921127_1921880_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|1921887_1922283_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|1922279_1922855_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|1922869_1923223_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|1923215_1923584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|1923635_1924664_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|1924721_1925069_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|1925105_1926611_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_001387697.1|1926600_1928193_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|1928189_1928396_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390573.1|1928379_1930308_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|1930279_1930828_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|1931228_1931633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|1932086_1932374_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|1932452_1932605_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|1932633_1932840_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|1933061_1933148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|1933702_1934236_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|1934278_1935085_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000874307.1|1935454_1937308_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
1936433:1936447	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000871291.1|1937568_1937904_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|1938184_1938316_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|1939114_1940164_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|1940314_1940512_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|1940738_1941560_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|1941556_1941931_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|1941943_1942990_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_001329966.1|1942991_1943264_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|1943431_1943644_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|1943824_1944490_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|1944664_1945090_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|1945130_1946093_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|1946115_1946541_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1946537_1946792_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1946871_1947291_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|1947587_1947740_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|1947751_1948090_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|1948078_1948273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1948839_1949028_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1949024_1949216_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|1949308_1951780_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|1951844_1952093_+	excisionase	NA	NA	NA	NA	NA
WP_000113686.1|1952070_1953201_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
1957372:1957386	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 8
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	2057219	2115907	5311821	holin,lysis,terminase,tRNA,head,tail,capsid,integrase	Enterobacteria_phage(41.18%)	68	2065510:2065524	2116009:2116023
WP_001297484.1|2057219_2058326_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2058361_2059003_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2059006_2060377_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2060544_2061216_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2061215_2062676_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2062751_2063873_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359463.1|2064018_2065248_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2065497_2066634_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2065510:2065524	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2066617_2067481_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000885609.1|2067712_2068294_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.8e-103
WP_000279201.1|2068293_2071086_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	5.2e-12
WP_001233150.1|2071150_2071750_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	98.0	9.7e-110
WP_000515046.1|2071817_2075291_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
WP_123001620.1|2075531_2076164_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.4e-103
WP_000194711.1|2076109_2076853_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_001335877.1|2076863_2077562_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000847306.1|2077561_2077891_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000081807.1|2077887_2080500_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	90.3	0.0e+00
WP_000533440.1|2080480_2080894_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479049.1|2080920_2081343_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	3.7e-71
WP_000235035.1|2081356_2082109_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	6.0e-133
WP_000683079.1|2082116_2082512_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975003.1|2082508_2083084_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204567.1|2083099_2083453_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001390684.1|2083445_2083814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522644.1|2083866_2084895_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	7.3e-113
WP_000256795.1|2084952_2085300_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_001254006.1|2085336_2086842_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000259002.1|2088419_2088626_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001402639.1|2088609_2090538_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000235436.1|2090509_2091019_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001329960.1|2091420_2091606_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|2091738_2091879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082546.1|2092229_2092697_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_001092864.1|2092995_2093529_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_000731195.1|2093571_2094378_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	95.1	2.5e-145
WP_000284510.1|2094382_2094598_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021519714.1|2094748_2096602_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.8	0.0e+00
WP_000935531.1|2097391_2098441_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.5	6.1e-200
WP_000917749.1|2098591_2098789_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762898.1|2099015_2099837_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	1.3e-80
WP_000904113.1|2099833_2100208_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_001265094.1|2100220_2101270_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_001341382.1|2101271_2101550_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000813254.1|2101717_2101873_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753058.1|2102794_2102971_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001224662.1|2102963_2103146_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403778.1|2103239_2103596_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000207966.1|2103573_2103717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224227.1|2103727_2103991_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001289900.1|2104913_2105663_-	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.1	1.8e-108
WP_000034251.1|2105659_2106346_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.3e-38
WP_001275731.1|2106332_2106827_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.9e-66
WP_000416574.1|2106823_2107246_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	76.1	1.6e-53
WP_000095671.1|2107286_2108249_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693845.1|2108271_2108697_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048458.1|2108680_2108956_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|2109063_2109564_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100896.1|2109581_2109773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|2109772_2110063_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379548.1|2110332_2110485_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2110496_2110835_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|2110823_2111018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2111584_2111773_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2111769_2111958_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102130.1|2112050_2114489_+	exonuclease	NA	A0A088CD28	Shigella_phage	45.0	2.9e-112
WP_000003742.1|2114550_2114820_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2114788_2115907_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2116009:2116023	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 9
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	2289556	2381097	5311821	holin,lysis,transposase,portal,terminase,tail,capsid,bacteriocin,integrase	Escherichia_phage(85.71%)	96	2288095:2288110	2341735:2341750
2288095:2288110	attL	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_000279857.1|2289556_2290774_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|2291321_2292308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|2292304_2292796_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_085948466.1|2292898_2294060_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409841.1|2294101_2295460_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287459.1|2296046_2298470_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|2298478_2300497_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|2300489_2301815_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|2301816_2302230_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000533522.1|2302279_2303068_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001199172.1|2303686_2304958_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|2304963_2306091_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2306148_2306979_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|2307520_2309029_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2309187_2309397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|2309451_2313414_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2313453_2314092_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2314379_2315471_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2315470_2316163_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|2316174_2316561_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|2316568_2317369_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|2317378_2317969_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|2317979_2318474_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|2318494_2319823_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|2319905_2320079_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000331688.1|2321010_2329392_-	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
WP_000012452.1|2329461_2330727_-	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000540391.1|2330737_2330989_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|2330998_2331445_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509482.1|2331447_2332104_-	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000035557.1|2332198_2332600_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|2332656_2332797_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|2333027_2333762_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|2333852_2334470_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|2334475_2334754_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|2334768_2336037_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_024199968.1|2336033_2337659_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|2337892_2338405_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_000117976.1|2338491_2341083_-|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000207922.1|2341079_2341730_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|2341729_2342293_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
2341735:2341750	attR	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_001290743.1|2342276_2342738_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140445.1|2342788_2343178_-	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_000214467.1|2343232_2344447_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_000345015.1|2344470_2345478_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000787518.1|2345635_2347780_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|2347779_2349486_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|2349466_2350273_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|2350328_2350532_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|2350681_2350975_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|2351006_2351471_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|2351478_2351628_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|2351627_2352197_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|2352471_2353005_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001072899.1|2353009_2353225_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2353302_2353548_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2353588_2353768_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874432.1|2353904_2355842_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|2356327_2356597_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2356608_2357568_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|2357950_2358103_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|2358351_2358786_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|2358778_2358973_-	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|2358969_2359533_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|2359540_2359990_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|2359989_2360961_-	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|2360950_2362471_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|2362464_2362842_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|2363008_2363203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|2363373_2363577_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|2363672_2364386_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|2364480_2365950_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|2365946_2366900_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_113690331.1|2367517_2368303_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.6e-139
WP_000917252.1|2368373_2368586_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|2368597_2368879_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|2368899_2369181_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|2369197_2370148_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|2370144_2370834_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|2370833_2371421_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|2371495_2371843_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|2371906_2372728_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|2372804_2373200_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|2373350_2374076_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|2374072_2374480_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|2374481_2374673_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|2374675_2375572_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203837.1|2375927_2376212_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000211520.1|2376461_2377091_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|2377146_2377578_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|2377574_2378201_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|2378160_2378373_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994793.1|2378408_2378789_+	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_000497812.1|2379152_2379404_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|2379449_2379734_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_001401545.1|2379786_2381097_+	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
>prophage 10
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	2591913	2688455	5311821	lysis,transposase,portal,head,tail,capsid,integrase	Enterobacteria_phage(46.97%)	108	2618197:2618231	2689889:2689923
WP_000399648.1|2591913_2592894_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|2593172_2594765_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|2594983_2595904_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|2595962_2597081_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|2597077_2597545_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|2597730_2597859_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054697.1|2598130_2599714_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|2599762_2600278_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2600330_2600396_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|2600630_2601518_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2601816_2602320_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2602723_2603470_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2603608_2604268_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2604264_2604987_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267242.1|2605103_2607329_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001387659.1|2607325_2608252_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001387658.1|2608527_2608788_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430039.1|2609052_2611335_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990161.1|2611376_2612054_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000146343.1|2612127_2612394_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2612658_2612919_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|2613147_2614233_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|2614373_2615336_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|2615363_2617514_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|2617633_2618116_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
2618197:2618231	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|2618347_2619712_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2619940_2620612_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2620614_2621610_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2621602_2623339_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2623331_2624465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2624475_2625582_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2625543_2625954_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|2626086_2626848_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2626844_2628086_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|2628085_2629042_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|2629077_2629791_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|2629860_2630508_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|2630709_2631414_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|2631550_2632003_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598616.1|2632004_2632250_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2632242_2632728_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|2632730_2633243_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|2633264_2634254_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|2634650_2635559_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|2635750_2637772_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2638357_2639035_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2639027_2639783_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|2639769_2640924_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2640920_2641961_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|2642047_2643337_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|2643395_2643872_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|2644617_2645949_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000885623.1|2646022_2646607_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_001387657.1|2646606_2649681_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|2649745_2650345_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515639.1|2650415_2653913_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090917.1|2653973_2654606_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|2654542_2655286_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_001152576.1|2655291_2655990_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000847379.1|2655989_2656319_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_175384119.1|2656315_2657131_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	2.0e-97
WP_138223807.1|2657127_2658876_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.6	1.3e-300
WP_000459457.1|2658868_2659303_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|2659284_2659707_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001390429.1|2659722_2660463_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683129.1|2660470_2660866_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|2660862_2661441_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|2661452_2661806_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|2661817_2662213_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|2662254_2663280_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|2663335_2663668_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|2663677_2664997_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001316944.1|2664977_2666579_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|2666575_2666782_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453580.1|2668677_2669223_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|2669611_2669845_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|2669901_2670312_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|2670661_2671183_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|2671387_2671825_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|2671821_2672319_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|2672318_2672534_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|2673122_2674205_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|2674393_2674777_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2674862_2675003_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_000774504.1|2675357_2675648_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|2675640_2675811_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|2675810_2676266_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|2676262_2676364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|2676460_2676712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|2677288_2677528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145901.1|2678679_2678982_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|2678978_2679680_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147903.1|2679676_2680696_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_001182903.1|2680692_2681232_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|2681301_2681532_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2681637_2682327_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|2682924_2683131_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|2683206_2683503_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2683508_2684294_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|2684290_2684971_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|2684967_2685150_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|2685122_2685314_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_001386642.1|2685324_2685606_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|2685704_2685926_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|2686136_2686739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|2686981_2687149_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|2687188_2687407_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|2687384_2688455_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
2689889:2689923	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 11
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	3194094	3250056	5311821	integrase,plate,transposase	Escherichia_phage(18.18%)	54	3193783:3193796	3209785:3209798
3193783:3193796	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_001269640.1|3194094_3195372_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000378354.1|3195452_3195737_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	57.7	5.1e-16
WP_000019440.1|3195817_3196798_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000891726.1|3197376_3199218_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_001387927.1|3199252_3199450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999102.1|3199601_3200633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|3200647_3201031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|3201035_3201233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390662.1|3202223_3202523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|3202522_3202726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532776.1|3202783_3203167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221926.1|3203264_3203534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594462.1|3203543_3204212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296967.1|3204359_3204542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|3206216_3206768_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000550450.1|3207108_3207267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|3207333_3207486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893256.1|3208282_3209536_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001285288.1|3209547_3210651_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
3209785:3209798	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_000749877.1|3210938_3211994_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|3212032_3212434_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3212491_3213736_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3213827_3214286_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293014.1|3214546_3216004_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|3216060_3216675_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|3216671_3217811_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|3218056_3218509_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|3218505_3219561_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207574.1|3219631_3220417_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001386594.1|3220361_3222101_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598758.1|3222205_3222484_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|3222476_3222833_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|3222889_3223663_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|3223848_3224109_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615974.1|3224111_3224390_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3224545_3225286_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3225256_3226024_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3226229_3226808_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|3227047_3229492_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3229534_3230008_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|3230161_3230932_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|3233419_3233605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|3233519_3234002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103304.1|3237724_3239866_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|3240075_3240594_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|3241290_3241791_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3241825_3242050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3242100_3243576_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611748.1|3243582_3243996_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|3243999_3245850_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3245813_3246896_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3246920_3248201_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3248197_3248722_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|3248724_3250056_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 12
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	3566715	3630712	5311821	holin,transposase	Stx2-converting_phage(33.33%)	59	NA	NA
WP_000181142.1|3566715_3567672_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.7e-61
WP_001137018.1|3568138_3569371_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|3569411_3570692_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001298930.1|3570807_3571959_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|3571968_3572736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|3572732_3572990_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|3573054_3573915_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141192.1|3573982_3575161_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151854.1|3575173_3575728_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|3575977_3576661_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|3576657_3577119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568407.1|3577131_3578304_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|3578368_3579280_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|3579272_3579665_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|3579661_3579745_-	iraD leader peptide IdlP	NA	NA	NA	NA	NA
WP_000062571.1|3580336_3581167_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833686.1|3581307_3582081_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|3582295_3583756_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|3583836_3585021_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|3585360_3586704_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000250224.1|3587810_3588488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|3589319_3589517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|3589688_3590291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|3590385_3590664_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840367.1|3590732_3590999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|3592216_3592786_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270971.1|3593045_3593447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221614.1|3593434_3593869_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001390365.1|3594223_3594604_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.9e-64
WP_000612591.1|3594600_3594948_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998014.1|3594997_3596383_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.4e-257
WP_000823241.1|3596621_3597980_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3598730_3598988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3599905_3600427_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|3600423_3601377_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188245.1|3601463_3603788_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|3603832_3604735_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|3604731_3605730_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3605726_3606683_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3606683_3607451_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3608008_3608266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189126.1|3608916_3610425_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_160371899.1|3612000_3612843_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001388979.1|3612845_3613934_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001387303.1|3613938_3614889_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001390363.1|3614953_3615898_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|3616078_3617218_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|3617371_3619369_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|3619431_3620709_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145474.1|3620954_3621611_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001422798.1|3621791_3621920_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000422741.1|3622058_3622484_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3622480_3622831_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|3622861_3624475_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001295538.1|3625658_3626441_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|3626746_3627667_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|3627694_3629011_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|3629022_3630036_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|3630457_3630712_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 13
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	3690060	3748604	5311821	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|3690060_3691413_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|3691506_3692058_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219816.1|3692208_3693582_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|3693757_3694756_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|3694788_3695784_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001387274.1|3695770_3696793_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|3696806_3698309_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|3698618_3699575_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|3699884_3700415_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|3700494_3700845_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|3700838_3701090_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|3701301_3701643_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060946.1|3701645_3705425_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|3705421_3707155_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|3707360_3707999_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|3708321_3709665_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|3709726_3709933_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|3710257_3710815_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|3710804_3711545_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589423.1|3711734_3713678_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|3713806_3714187_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|3714275_3715136_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|3715243_3716209_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|3716316_3716979_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|3717023_3718436_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|3718744_3719365_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|3719583_3720222_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|3720356_3721565_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|3721572_3722004_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|3722626_3723421_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|3723491_3723941_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|3723982_3724210_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|3724214_3724529_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|3724535_3724931_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|3725257_3725533_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|3725607_3726159_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|3726255_3726942_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|3726941_3727796_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|3727805_3728456_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|3728469_3728934_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|3728943_3729249_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|3729264_3730662_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|3731016_3732081_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|3732188_3732944_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|3732940_3733690_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|3733871_3734201_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|3734349_3734625_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|3734741_3736367_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|3736450_3737614_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|3737616_3738255_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|3738680_3739340_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|3739390_3740089_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|3740107_3740509_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|3740635_3741367_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|3741546_3743988_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|3744026_3744452_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3744656_3745955_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3746058_3746256_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3746337_3747342_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|3747344_3748604_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 14
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	4393778	4410404	5311821	integrase,transposase	Escherichia_phage(40.0%)	16	4401573:4401632	4406826:4407646
WP_001067855.1|4393778_4394483_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|4394543_4395380_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|4395379_4396183_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|4396243_4397059_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|4397366_4398218_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|4398973_4399678_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|4400177_4401038_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
4401573:4401632	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4401635_4402340_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|4402536_4402887_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|4403089_4404103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|4404260_4404734_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|4404963_4405311_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|4405304_4406084_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|4406117_4406822_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137316.1|4406880_4407435_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|4407437_4410404_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
4406826:4407646	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCGCATTGGGTATATCAGGGTCAGCACCTTCGACCAGAACCCGGAACGGCAACTGGAAGGCGTCAAGGTTGATCGCGCTTTTAGCGACAAGGCATCCGGCAAGGATGTCAAGCGTCCGCAACTGGAAGCGCTGATAAGCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATCTCGATGATTTGCGCCGGATCGTGCAAACGCTGACACAACGCGGCGTGCATATCGAATTCGTCAAGGAACACCTCAGTTTTACTGGCGAAGACTCTCCGATGGCGAACCTGATGCTCTCGGTGATGGGCGCGTTCGCCGAGTTCGAGCGCGCCCTGATCCGCGAGCGTCAGCGCGAGGGTATTGCGCTCGCCAAGCAACGCGGGGCTTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTTGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCCATCCTGTCCGCCGCCGAGCGGGAAAGCCTGCTGGCGTTGCCGGACTCCAAGGACGACCTGATCCGACATTACACATTCAACGATACCGACCTCTCGATCATCCGACAGCGGCGCGGGCCAGCCAATCGGCTGGGCTTCGCGGTGCAGCTCTGTTACCTGCGCTTTCCCGGCGTCATCCTGGGCGTCGATGAACT	NA	NA	NA	NA
>prophage 15
NZ_CP023531	Escherichia coli strain FDAARGOS_401 chromosome, complete genome	5311821	5210712	5235745	5311821	plate,transposase	Escherichia_phage(50.0%)	16	NA	NA
WP_001390300.1|5210712_5212515_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|5212505_5213438_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|5213450_5215433_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|5215443_5215911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|5215920_5216220_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001033155.1|5216223_5217300_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|5217307_5217859_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001154665.1|5217877_5219290_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|5219628_5220219_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|5220224_5223629_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|5223632_5226182_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000587872.1|5229347_5229914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|5230392_5231547_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000555380.1|5232861_5233995_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|5234034_5234397_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000019440.1|5234764_5235745_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 1
NZ_CP023530	Escherichia coli strain FDAARGOS_401 plasmid unnamed, complete sequence	75554	47254	54208	75554	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000205736.1|47254_48001_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139330.1|48055_48616_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001387845.1|48844_49279_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000624689.1|49275_49572_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_000381397.1|49884_51456_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624622.1|51475_51823_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|51822_52500_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000019427.1|53227_54208_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
