The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	393858	412652	4469608	integrase,tail	Salmonella_phage(72.22%)	22	393269:393287	413297:413315
393269:393287	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_059178526.1|393858_394911_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.9	2.0e-102
WP_059178525.1|394994_396356_-	KAP family NTPase	NA	R9TRQ8	Vibrio_phage	29.2	2.5e-20
WP_059178524.1|396569_397139_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	46.9	6.3e-42
WP_004223867.1|397264_397486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059178523.1|397518_398028_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	81.0	3.1e-72
WP_072241800.1|398035_398236_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	89.2	2.8e-29
WP_059178522.1|398199_398541_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	87.6	1.2e-48
WP_059178521.1|398608_398845_+	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	63.1	2.2e-12
WP_059178520.1|398844_399072_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	78.7	3.0e-27
WP_059178519.1|399091_401473_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.3	0.0e+00
WP_059178517.1|402075_402891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059178516.1|402892_403594_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	32.1	9.6e-08
WP_096759576.1|404503_404947_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	3.5e-56
WP_059178514.1|405120_406020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059178513.1|406016_406361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059178512.1|406532_407645_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.7	2.7e-198
WP_059178511.1|407654_408170_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	1.6e-89
WP_059178510.1|408223_408526_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	94.0	3.3e-42
WP_072241798.1|408540_410790_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	66.8	1.9e-251
WP_059178508.1|410786_411272_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	86.9	4.2e-71
WP_059178507.1|411268_412369_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	90.7	3.3e-180
WP_012016760.1|412436_412652_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	1.2e-22
413297:413315	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 2
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	1274331	1293544	4469608	holin,terminase	Shigella_phage(22.22%)	25	NA	NA
WP_059179013.1|1274331_1274913_+	hypothetical protein	NA	A0A125RNP0	Pseudomonas_phage	65.0	5.6e-62
WP_059179014.1|1275111_1275429_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	59.6	2.1e-31
WP_059179016.1|1275780_1276143_+	GtrA family protein	NA	U5P0S6	Shigella_phage	80.8	6.4e-48
WP_059179017.1|1276139_1277057_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	89.1	1.5e-157
WP_133115695.1|1277231_1278713_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	37.0	1.9e-77
WP_059179019.1|1278744_1280715_-	hypothetical protein	NA	B1GS50	Salmonella_phage	64.4	7.8e-55
WP_059179020.1|1281612_1282215_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	79.8	6.0e-75
WP_059179021.1|1282292_1282727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082691922.1|1282709_1282823_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_059179022.1|1282843_1283389_+	hypothetical protein	NA	S4TR57	Salmonella_phage	40.8	8.2e-23
WP_059179023.1|1283397_1283589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059179024.1|1283703_1283934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059179025.1|1284167_1284554_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	39.5	3.5e-12
WP_096759583.1|1284550_1284994_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	67.8	1.3e-47
WP_059179027.1|1284977_1285319_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	2.4e-28
WP_128131049.1|1285480_1285975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096759584.1|1286324_1286597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059179030.1|1286690_1287380_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.1e-55
WP_059179031.1|1288249_1288585_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	84.8	5.7e-43
WP_059179032.1|1288681_1288885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059179034.1|1289248_1289764_+	hypothetical protein	NA	R9TNF9	Aeromonas_phage	36.5	4.4e-10
WP_059179035.1|1289804_1290059_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	44.3	8.8e-12
WP_059179036.1|1290090_1291368_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	55.8	1.8e-137
WP_072241842.1|1291424_1292378_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	68.5	1.4e-129
WP_059179038.1|1292386_1293544_+	hypothetical protein	NA	A0A125RNN9	Pseudomonas_phage	38.4	4.0e-59
>prophage 3
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	1314937	1323904	4469608	tail,terminase	Salmonella_phage(28.57%)	9	NA	NA
WP_059179053.1|1314937_1315609_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.9	9.0e-80
WP_059179054.1|1315843_1316455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059179055.1|1316571_1317840_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	2.1e-231
WP_059179056.1|1317843_1318263_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	5.0e-36
WP_059179057.1|1318415_1318985_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.1	3.3e-75
WP_072241844.1|1319115_1319823_+	hypothetical protein	NA	K7PM99	Enterobacterial_phage	58.8	2.3e-70
WP_174521008.1|1319788_1320895_-|tail	tail fiber domain-containing protein	tail	K7PM99	Enterobacterial_phage	61.7	8.2e-78
WP_059179058.1|1321021_1321384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059179059.1|1322896_1323904_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	40.2	8.6e-34
>prophage 4
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	1327859	1344725	4469608	tRNA	Enterobacteria_phage(33.33%)	16	NA	NA
WP_059179064.1|1327859_1328675_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	80.8	3.3e-124
WP_059179065.1|1328671_1328812_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.1	5.2e-06
WP_059179144.1|1328808_1329414_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	65.8	1.8e-55
WP_072241846.1|1329416_1329623_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	65.2	2.2e-21
WP_059179066.1|1329622_1330225_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	84.0	2.1e-96
WP_072241848.1|1331257_1332598_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_059179068.1|1332594_1333710_+	macro domain-containing protein	NA	A0A2D1GR68	Pseudomonas_phage	42.1	1.6e-25
WP_059179069.1|1334646_1335336_-	phage replication protein	NA	G8C7U6	Escherichia_phage	62.9	3.1e-83
WP_059179070.1|1335332_1336250_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	72.0	1.0e-110
WP_059179071.1|1336334_1336874_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	4.6e-58
WP_059179072.1|1339483_1340524_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	72.4	1.9e-148
WP_059179073.1|1340562_1340805_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_022651304.1|1340869_1341082_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
WP_059179074.1|1341083_1342322_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.7	2.0e-170
WP_059179075.1|1342371_1343307_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	2.4e-139
WP_059179076.1|1343351_1344725_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.8e-50
>prophage 5
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	1775274	1782798	4469608		Enterobacteria_phage(28.57%)	7	NA	NA
WP_059179556.1|1775274_1775811_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	1.0e-49
WP_059179802.1|1775814_1776693_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.8	1.1e-106
WP_059179555.1|1776739_1777639_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.0	5.3e-27
WP_059179554.1|1777638_1778724_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.1e-100
WP_059179553.1|1779102_1779999_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.5	3.7e-44
WP_059179552.1|1780216_1781212_-	NAD-dependent epimerase/dehydratase family protein	NA	Q6VZT4	Canarypox_virus	25.1	6.8e-07
WP_059179551.1|1781400_1782798_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.6	5.8e-20
>prophage 6
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	1838329	1864377	4469608	terminase,tail,tRNA,capsid,portal,integrase,plate,lysis	Escherichia_phage(27.27%)	31	1839840:1839861	1864462:1864483
WP_059179506.1|1838329_1839691_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	89.9	3.0e-199
1839840:1839861	attL	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
WP_034496757.1|1840087_1841062_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016246480.1|1841190_1841970_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016246481.1|1842242_1842731_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_059179505.1|1842776_1843985_-	MFS transporter	NA	NA	NA	NA	NA
WP_072241892.1|1844405_1844627_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	74.0	7.6e-28
WP_096759536.1|1845575_1845971_-|plate	baseplate J-like protein	plate	A0A0F7LCQ9	Escherichia_phage	81.2	1.2e-50
WP_059179184.1|1845976_1846327_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	71.6	4.7e-40
WP_059179185.1|1846323_1846965_-|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	79.3	2.0e-92
WP_059179186.1|1848262_1849054_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_059179187.1|1849274_1849739_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.9	9.7e-49
WP_059179188.1|1849731_1850199_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.0e-61
WP_059179189.1|1850294_1850729_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.1	8.8e-44
WP_059179190.1|1850710_1851139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059179191.1|1851135_1851648_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.5	8.1e-81
WP_059179192.1|1852240_1853335_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	82.8	1.1e-167
WP_059179193.1|1853391_1854246_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	75.4	4.3e-119
WP_059179194.1|1854412_1856182_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.0	7.4e-299
WP_059179195.1|1856183_1857200_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	85.1	9.9e-171
WP_156421720.1|1857432_1857621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059179197.1|1857713_1857905_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	85.7	4.9e-23
WP_059179198.1|1857903_1858335_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	95.1	3.4e-72
WP_059179199.1|1858400_1858616_-	hypothetical protein	NA	Q6K1F0	Salmonella_virus	67.6	6.3e-19
WP_059179200.1|1858803_1861086_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	75.8	0.0e+00
WP_059179201.1|1861075_1861351_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	60.4	1.2e-25
WP_072241869.1|1861372_1861597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059179202.1|1861599_1861821_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_059179203.1|1861885_1862386_-	hypothetical protein	NA	M1SV55	Escherichia_phage	84.3	7.4e-79
WP_059179204.1|1862552_1862828_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	85.7	1.2e-41
WP_059179205.1|1862949_1863249_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	70.7	3.9e-35
WP_059179206.1|1863363_1864377_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	84.6	2.5e-166
1864462:1864483	attR	CCCTTACGCAGGCTTATTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP023529	Lelliottia amnigena strain FDAARGOS_395 chromosome, complete genome	4469608	4003841	4011074	4469608	integrase	Enterobacteria_phage(85.71%)	10	4003655:4003671	4015525:4015541
4003655:4003671	attL	TTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_059180011.1|4003841_4005101_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.4	6.9e-81
WP_059180012.1|4005261_4007595_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	81.1	0.0e+00
WP_059180013.1|4007609_4007930_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_059180014.1|4007926_4008154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059180015.1|4008150_4008702_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	4.2e-35
WP_059180016.1|4008698_4008965_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	3.7e-29
WP_164841560.1|4009295_4009475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059180017.1|4009516_4010251_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	54.3	9.0e-65
WP_059180018.1|4010247_4010511_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.9e-19
WP_059180019.1|4010507_4011074_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	8.2e-58
4015525:4015541	attR	TTCGAGTCCGGCCTTCG	NA	NA	NA	NA
