The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023516	Pasteurella multocida strain FDAARGOS_384 chromosome, complete genome	2346722	3936	114347	2346722	holin,terminase,capsid,tail,plate,tRNA,integrase	Haemophilus_phage(26.92%)	136	57275:57302	113545:113572
WP_005756524.1|3936_4329_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_096742887.1|4341_4620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742888.1|4685_7292_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	33.9	3.0e-86
WP_096742889.1|7452_8286_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_096742890.1|8372_9392_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_010906757.1|9544_12154_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.2	2.4e-19
WP_010906758.1|12324_12825_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.6	1.7e-19
WP_096742891.1|12889_13978_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_005751474.1|14121_15312_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_096742892.1|15372_15825_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_096742893.1|15825_16071_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_096742894.1|16083_16560_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_096742895.1|16619_17633_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010906761.1|18005_18932_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.8	3.1e-30
WP_096742896.1|18951_19437_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	37.5	4.2e-10
WP_005722212.1|19519_19816_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.6e-12
WP_096742897.1|19819_22207_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_050547921.1|22229_22679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742898.1|22719_23703_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.8	5.4e-33
WP_096742899.1|23881_24400_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_096742900.1|24428_25091_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010906766.1|25198_25849_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	32.7	5.8e-07
WP_096742901.1|25879_27208_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_005751483.1|27200_28115_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_096742902.1|28198_28993_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_096742903.1|29150_29993_+	patatin family protein	NA	NA	NA	NA	NA
WP_005756556.1|30261_30519_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	60.0	1.4e-20
WP_096742904.1|30508_31096_-	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	33.2	1.2e-30
WP_096742905.1|31106_32615_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	45.0	1.2e-74
WP_096742906.1|32627_33206_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	69.1	3.4e-75
WP_096742907.1|33205_34345_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	65.8	2.9e-139
WP_096742908.1|34355_34709_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	5.7e-41
WP_096742909.1|34705_35374_-|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	62.6	1.2e-71
WP_096742910.1|35431_35683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742911.1|35822_36074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742912.1|36164_36830_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	54.9	4.7e-20
WP_096742913.1|37134_37623_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_096742914.1|37600_37807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742915.1|38131_39076_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_096742916.1|39227_39755_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	31.5	2.6e-18
WP_096742917.1|39951_40791_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	76.4	9.1e-122
WP_096742918.1|40759_41092_-	hypothetical protein	NA	D0UII0	Aggregatibacter_phage	79.0	1.8e-41
WP_096742919.1|41107_41875_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	56.8	3.3e-70
WP_096742920.1|41887_43513_-|tail	phage tail tape measure protein	tail	Q7Y5T2	Haemophilus_phage	41.2	2.8e-87
WP_071523250.1|43657_44074_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	60.1	3.7e-39
WP_096742921.1|44077_44506_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	71.1	3.5e-53
WP_096742922.1|44517_46026_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	71.1	3.1e-205
WP_096742923.1|46025_46397_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	57.1	8.0e-30
WP_096742924.1|46461_46836_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	58.1	4.2e-34
WP_096742925.1|46832_47279_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	54.1	6.5e-42
WP_096742926.1|47275_47635_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	57.6	4.4e-33
WP_096742927.1|47644_48559_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	51.0	1.2e-77
WP_096742928.1|48578_49028_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	55.0	1.2e-27
WP_096742929.1|49039_50107_-	DUF2213 domain-containing protein	NA	D0UIJ2	Aggregatibacter_phage	63.3	2.1e-94
WP_096743999.1|50214_51744_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	55.0	2.3e-70
WP_096744000.1|51706_53008_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	54.7	2.4e-129
WP_096744001.1|53016_54402_-|terminase	phage terminase large subunit	terminase	D0UIJ7	Aggregatibacter_phage	81.5	2.7e-227
WP_096742930.1|54424_54952_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	66.4	1.4e-48
WP_096742931.1|55036_55222_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	76.9	2.0e-05
WP_096742932.1|55250_55685_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PK80	Moraxella_phage	35.2	1.3e-18
WP_096742934.1|55902_56226_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_096742935.1|56198_56729_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	4.4e-45
WP_096742936.1|56725_57022_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	50.0	4.9e-14
57275:57302	attL	GGTGAATCATACTTACACTACGACCACC	NA	NA	NA	NA
WP_014391474.1|57347_57809_-	antitermination protein	NA	NA	NA	NA	NA
WP_096742937.1|57810_58413_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	38.2	3.7e-32
WP_096742939.1|58730_58931_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	69.4	6.7e-23
WP_096742940.1|59004_59463_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	54.1	4.5e-38
WP_096742941.1|59466_60903_-	AAA family ATPase	NA	Q7Y5V9	Haemophilus_phage	63.0	1.3e-173
WP_096742942.1|60902_61967_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	73.8	1.2e-57
WP_096742943.1|62202_62403_-	hypothetical protein	NA	D0UIL7	Aggregatibacter_phage	71.1	3.0e-07
WP_096742944.1|62405_62858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742945.1|62905_63097_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	56.9	4.7e-10
WP_096742946.1|63194_63845_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.0	1.2e-28
WP_096742947.1|63849_65757_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096742948.1|66207_66435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742949.1|66581_66863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742950.1|66849_67077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172452375.1|67090_67252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742951.1|67424_68069_+	ribonuclease H-like domain-containing protein	NA	R9ZX90	Cellulophaga_phage	25.0	2.0e-07
WP_096742952.1|68072_68738_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	54.5	2.1e-65
WP_096742953.1|68740_69343_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	45.1	1.3e-32
WP_096742954.1|69400_70069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742956.1|70312_70705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742957.1|70701_71013_+	hypothetical protein	NA	Q6J1P1	Burkholderia_virus	40.8	8.0e-07
WP_096742958.1|71090_71474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742959.1|71476_72385_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	44.5	9.1e-59
WP_096742960.1|72528_73014_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	42.2	1.5e-23
WP_096742961.1|73016_73247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096742962.1|73300_73792_+	pyruvate kinase	NA	A0A0M3LPG0	Mannheimia_phage	45.6	5.0e-27
WP_096742963.1|73796_74111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042742798.1|74146_74398_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_096742964.1|74399_75431_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	64.8	3.7e-125
WP_005716009.1|75582_75867_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_083002187.1|76084_76699_+	DedA family protein	NA	NA	NA	NA	NA
WP_083002189.1|76766_77501_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_005756709.1|77666_78878_-	ROK family protein	NA	NA	NA	NA	NA
WP_096742965.1|79172_80576_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	38.0	6.3e-83
WP_096742966.1|80636_82994_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_096742967.1|83039_83885_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.2	4.4e-47
WP_096742968.1|83962_85675_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_083002202.1|85676_86036_+	YraN family protein	NA	NA	NA	NA	NA
WP_096742969.1|86038_86626_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_083002207.1|86689_87274_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_096742970.1|87335_87950_-	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
WP_083002213.1|88005_89409_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_096742971.1|89408_90461_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_083002217.1|90590_92030_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_096742972.1|92594_93842_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	42.8	8.3e-79
WP_096742973.1|93867_94128_-	DNA helicase UvrD	NA	A0A0M3LNN9	Mannheimia_phage	58.8	4.8e-21
WP_192940542.1|94114_94708_-	DUF4376 domain-containing protein	NA	Q7Y5S1	Haemophilus_phage	39.8	2.6e-38
WP_192940543.1|94707_96195_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	46.6	1.0e-70
WP_096742975.1|96207_96786_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	69.6	3.4e-75
WP_096742976.1|96785_97925_-|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	65.3	3.8e-139
WP_096742977.1|97935_98289_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	66.7	5.1e-42
WP_096742978.1|98285_98939_-|plate	baseplate protein	plate	D0UIH7	Aggregatibacter_phage	60.9	1.6e-68
WP_096742979.1|99056_99314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742980.1|99372_99726_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_159074467.1|100690_100849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192940544.1|100998_101562_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096742982.1|101772_102918_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	32.5	1.0e-38
WP_096742916.1|103068_103596_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	31.5	2.6e-18
WP_096742983.1|103792_104632_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	74.3	1.7e-120
WP_096742984.1|104600_104933_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	78.0	1.4e-41
WP_096742985.1|104948_105716_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	58.0	8.7e-71
WP_192940545.1|105725_105962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096742988.1|106378_106798_-	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	62.8	1.4e-38
WP_096742989.1|106797_107016_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	72.2	4.6e-25
WP_138223025.1|107015_108056_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	27.6	6.1e-59
WP_096742991.1|108077_108275_-	recombinase	NA	NA	NA	NA	NA
WP_096742992.1|108392_109700_-	DUF1073 domain-containing protein	NA	D0UIJ6	Aggregatibacter_phage	55.6	7.3e-134
WP_096742993.1|111022_111475_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	56.4	2.3e-31
WP_096742994.1|111547_111730_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	6.5e-09
WP_096742995.1|111758_112193_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_096742997.1|112412_112745_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_096742998.1|113247_113472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005716039.1|114137_114347_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	57.1	1.4e-15
113545:113572	attR	GGTGAATCATACTTACACTACGACCACC	NA	NA	NA	NA
>prophage 2
NZ_CP023516	Pasteurella multocida strain FDAARGOS_384 chromosome, complete genome	2346722	499312	508670	2346722		Planktothrix_phage(33.33%)	9	NA	NA
WP_096743148.1|499312_500587_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.1	9.7e-91
WP_083005128.1|500627_501245_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_096743149.1|501244_502132_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|502201_503149_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_083005124.1|503223_504777_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|505011_505803_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_083005121.1|505811_506597_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_083005119.1|506674_507655_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.4e-19
WP_096743150.1|507671_508670_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP023516	Pasteurella multocida strain FDAARGOS_384 chromosome, complete genome	2346722	1022460	1030528	2346722		Escherichia_phage(66.67%)	7	NA	NA
WP_096743382.1|1022460_1024335_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.2	2.2e-14
WP_096743383.1|1024385_1024934_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_096744018.1|1024951_1025557_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.7	1.2e-22
WP_083004167.1|1025645_1026494_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.8	2.0e-20
WP_083004164.1|1026495_1027116_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.3	1.2e-70
WP_096743384.1|1027126_1029562_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	6.3e-224
WP_083004163.1|1029808_1030528_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.2	3.4e-16
>prophage 4
NZ_CP023516	Pasteurella multocida strain FDAARGOS_384 chromosome, complete genome	2346722	1565725	1637206	2346722	integrase,plate,transposase,tail,tRNA,head	Burkholderia_phage(20.0%)	85	1561473:1561489	1597291:1597307
1561473:1561489	attL	TTTAATTTCGCCGTTTG	NA	NA	NA	NA
WP_096743593.1|1565725_1568524_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	27.3	8.9e-89
WP_096743594.1|1568557_1569493_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_096743595.1|1569581_1571156_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005718552.1|1571467_1571731_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_046333738.1|1571789_1572470_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_046333739.1|1572549_1573512_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_096743597.1|1573518_1574010_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_005718542.1|1574099_1574363_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_108511585.1|1574809_1575274_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.2	2.3e-21
WP_096743598.1|1575753_1576671_-	inorganic pyrophosphatase	NA	A4JWK0	Burkholderia_virus	43.7	7.0e-67
WP_096743599.1|1576670_1577111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743600.1|1577122_1577698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725338.1|1577694_1578030_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_096743601.1|1578420_1580214_-	D5 N like family protein	NA	Q7M2A8	Enterobacteria_phage	34.5	4.4e-57
WP_005725335.1|1580203_1580392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743602.1|1580391_1580685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096744027.1|1580677_1581244_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046333744.1|1581324_1581516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096743603.1|1582038_1583274_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	36.5	2.7e-74
WP_096743604.1|1583834_1585115_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_046333747.1|1585111_1585672_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_083003433.1|1585695_1586685_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_083003430.1|1587037_1588051_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005718532.1|1588071_1589076_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_083003424.1|1589077_1589704_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_096743605.1|1589882_1590743_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005718523.1|1590735_1591689_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083003419.1|1591710_1592166_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_083003416.1|1592214_1593192_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005718519.1|1593245_1593722_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_096743606.1|1593721_1595014_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_096743607.1|1595024_1595696_+	cyclase family protein	NA	NA	NA	NA	NA
WP_096743608.1|1595708_1596758_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_096743609.1|1596775_1597726_+	transaldolase	NA	A0A127KNC6	Cyanophage	26.8	3.7e-10
1597291:1597307	attR	TTTAATTTCGCCGTTTG	NA	NA	NA	NA
WP_096743610.1|1598059_1598551_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	61.0	8.4e-51
WP_096743611.1|1599168_1600800_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	41.1	2.8e-50
WP_096743612.1|1600836_1601403_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	47.2	1.3e-42
WP_096743613.1|1601395_1602502_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	38.3	8.2e-62
WP_096743614.1|1602498_1602864_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	34.2	6.1e-06
WP_096744029.1|1602918_1603533_-|plate	phage baseplate assembly protein V	plate	A0A291LA20	Bordetella_phage	43.2	9.6e-12
WP_096743615.1|1603532_1604714_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	41.9	1.5e-66
WP_096743616.1|1604706_1604937_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	43.3	6.8e-11
WP_096743617.1|1604917_1605856_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	31.8	2.0e-21
WP_096743618.1|1605855_1608120_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	34.8	2.5e-57
WP_096743619.1|1608158_1608419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096743620.1|1608431_1608554_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_096743621.1|1608580_1608835_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	39.2	3.6e-05
WP_096743622.1|1608934_1609453_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	46.7	1.3e-38
WP_096743623.1|1609463_1610849_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	44.1	4.0e-98
WP_096743624.1|1610858_1611344_-	hypothetical protein	NA	A4JWK3	Burkholderia_virus	36.0	1.1e-21
WP_096743625.1|1611345_1611780_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	41.0	4.4e-19
WP_096743626.1|1611779_1612124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743627.1|1612194_1613121_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	47.9	1.6e-74
WP_096743628.1|1613132_1614245_-	peptidase	NA	A4JWJ9	Burkholderia_virus	39.9	1.4e-69
WP_096743629.1|1614494_1614959_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	32.0	1.4e-10
WP_096743630.1|1615084_1616341_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.2	5.3e-57
WP_096743631.1|1616337_1617768_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	44.8	2.1e-110
WP_096743632.1|1617767_1619324_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	62.2	3.1e-163
WP_064775717.1|1619326_1619908_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.5	2.4e-36
WP_096743633.1|1619930_1620233_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.4	8.3e-25
WP_064775719.1|1620229_1620559_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_096743634.1|1620676_1620937_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_096743635.1|1620933_1621164_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	69.3	7.4e-18
WP_192940539.1|1621147_1621507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192940540.1|1621506_1621650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083002521.1|1621658_1622195_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	68.6	7.2e-72
WP_096743636.1|1622281_1622671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743637.1|1623107_1623608_-	toxin	NA	L7THB5	Pseudomonas_virus	28.0	5.6e-10
WP_096743638.1|1623611_1623974_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	53.3	2.6e-25
WP_096743639.1|1624111_1624486_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.8	1.5e-23
WP_096743640.1|1624485_1625031_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	42.3	3.8e-36
WP_096743641.1|1625027_1625534_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	30.6	2.5e-13
WP_096743642.1|1625607_1626120_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	45.0	1.0e-27
WP_061406041.1|1626128_1626344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743643.1|1626361_1626553_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096743644.1|1626606_1627128_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	55.0	6.0e-47
WP_083002501.1|1627147_1627351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096743645.1|1627350_1628268_-	AAA family ATPase	NA	M4M9P4	Vibrio_phage	42.0	4.4e-61
WP_096743646.1|1628278_1630264_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0C4UR24	Shigella_phage	44.5	1.3e-155
WP_005719952.1|1630309_1630576_-	transcriptional regulator	NA	F6MII4	Haemophilus_phage	64.6	6.4e-21
WP_096743647.1|1630751_1631459_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	48.4	1.7e-52
WP_046333751.1|1631932_1633801_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	4.5e-36
WP_096743648.1|1633876_1635625_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.6	1.1e-41
WP_005717672.1|1635740_1635956_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_096743649.1|1636174_1637206_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.8e-111
