The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	185095	246564	5277336	holin,terminase,integrase,head,capsid,portal,tail,protease	Enterobacteria_phage(41.18%)	73	180911:180925	201850:201864
180911:180925	attL	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000113686.1|185095_186226_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
WP_000113189.1|186203_186452_-	excisionase	NA	NA	NA	NA	NA
WP_000048530.1|186516_188988_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_001090200.1|189080_189272_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|189268_189457_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001295058.1|190023_190218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|190206_190545_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379548.1|190556_190709_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000233320.1|191005_191425_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|191504_191759_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693888.1|191755_192181_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|192203_193166_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151211.1|193206_193632_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000150294.1|193806_194472_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|194652_194865_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|195032_195305_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265083.1|195306_196353_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_000904106.1|196365_196740_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_000762880.1|196736_197558_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917746.1|197784_197982_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000935536.1|198132_199182_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_001438304.1|199980_200112_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000871291.1|200392_200728_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874307.1|200988_202842_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
201850:201864	attR	AAACAAGAACACGGT	NA	NA	NA	NA
WP_000284510.1|202992_203208_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731197.1|203212_204019_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_001092853.1|204061_204595_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_032159578.1|205149_205236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|205457_205664_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|205692_205845_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|205923_206211_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|206664_207069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867569.1|207469_208018_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390573.1|207989_209918_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259002.1|209901_210108_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001387697.1|210104_211697_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_001253926.1|211686_213192_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000256823.1|213228_213576_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522596.1|213633_214662_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000201506.1|214713_215082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204198.1|215074_215428_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000974999.1|215442_216018_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_000683079.1|216014_216410_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235040.1|216417_217170_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000479095.1|217183_217615_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|217641_218055_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082359.1|218035_220609_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000847379.1|220605_220935_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|220934_221633_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000090879.1|222316_222919_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|222992_223331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515776.1|223397_226877_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001228314.1|226944_227544_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000216502.1|227695_230530_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_000885576.1|230529_231114_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000240999.1|231168_231837_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000926528.1|231893_232163_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000251936.1|232277_232448_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079509.1|232936_233443_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|233488_233989_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|234074_234254_-	general stress protein	NA	NA	NA	NA	NA
WP_000443069.1|234634_235441_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|235440_236634_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|236645_238007_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|238007_239603_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194599.1|239602_241165_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|241256_241301_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|241438_242320_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|242316_242937_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|243037_243910_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|243949_244540_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|244536_245295_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|245514_246564_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	534412	601384	5277336	holin,terminase,integrase,capsid,portal,tail,lysis	Shigella_phage(43.48%)	77	576875:576892	604925:604942
WP_000041536.1|534412_536839_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
WP_001342404.1|536899_539323_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000184488.1|539854_540490_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_000763355.1|540537_540759_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000020909.1|540755_541040_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_001290012.1|541026_541863_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000628768.1|542376_542880_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_000481378.1|542881_543157_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000331660.1|543280_551632_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000012439.1|551700_552966_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000540395.1|552976_553228_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000455643.1|553237_553684_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000509022.1|553686_554343_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_001387532.1|554434_554836_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000078908.1|554892_555033_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_000836186.1|555267_556005_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_001390575.1|556084_556702_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000455633.1|556707_556986_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_000038927.1|557000_558269_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_001146337.1|558265_559891_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000276176.1|560231_560459_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_000537686.1|560471_561017_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000117962.1|561099_563007_-|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000207910.1|563003_563654_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000829400.1|563653_564217_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_001290749.1|564200_564662_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_001140435.1|564712_565102_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_000214480.1|565156_566371_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_000344999.1|566393_567401_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000787512.1|567558_569703_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_001387707.1|569702_571409_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_001086085.1|571389_572205_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_000934362.1|572807_573389_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001082713.1|573469_573928_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000675931.1|573929_574043_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000087450.1|574263_574797_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000284506.1|574801_575017_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290236.1|575093_575339_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000142783.1|575364_575547_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_000874468.1|575685_577596_-	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
576875:576892	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_001204886.1|578361_578796_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000992060.1|578788_578983_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001008115.1|578982_579345_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000002252.1|579341_579632_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001254268.1|579655_579847_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_001076834.1|579843_580254_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_000211990.1|580308_580980_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_000042397.1|581686_582004_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000818160.1|582054_582540_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|582558_582738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|582947_583160_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_001278450.1|583348_583453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206792.1|583568_584153_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001118163.1|584209_584605_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000450864.1|584620_585391_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_000790392.1|585416_586157_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_001390256.1|586163_587246_-	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000438870.1|587266_587485_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_000438525.1|587499_587796_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000437871.1|587934_588135_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274758.1|588235_588949_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_001074607.1|588995_589538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|589525_590302_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000198438.1|590796_591180_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000211196.1|591183_591897_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_001005963.1|591928_592288_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000189936.1|592256_592466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560214.1|592922_593144_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000660961.1|593227_593614_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_001271588.1|593721_595794_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000995032.1|595790_596087_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_000100829.1|596092_596878_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000186868.1|596874_597555_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000497813.1|597602_597854_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_001387389.1|598115_599279_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000526492.1|599872_600727_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|600769_601384_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
604925:604942	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 3
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	728789	787369	5277336	holin,terminase,integrase,head,transposase,capsid,portal,tail,plate,tRNA	Enterobacteria_phage(77.55%)	71	724782:724798	776989:777005
724782:724798	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_000029466.1|728789_729539_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|729538_730090_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956518.1|730152_731133_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000416308.1|731322_731718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247218.1|731728_732664_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000094527.1|732752_733064_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|733155_733434_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917807.1|733448_733787_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000159452.1|733797_734085_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000514277.1|734096_734339_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021658.1|734335_734449_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_001038613.1|734537_734858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985715.1|734847_735051_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_000153687.1|735047_735293_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000104300.1|735289_735589_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_157847544.1|735600_736218_+	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000564228.1|736214_736604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272076.1|736600_739441_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000686540.1|739517_740477_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|740481_740796_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|740815_741247_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224219.1|741248_741512_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000087812.1|742023_743070_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613796.1|743069_744821_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262665.1|744975_745812_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_001055094.1|745835_746888_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632318.1|746933_747734_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_000063103.1|747835_748330_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864897.1|748329_748530_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|748532_748856_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072317.1|748852_749245_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000780558.1|749241_749649_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000202135.1|749787_751668_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000921128.1|751691_752159_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000356370.1|752151_752787_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_001342219.1|752798_753365_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_001067548.1|753382_753712_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111965.1|753715_754612_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000071739.1|754604_755135_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108557.1|755137_757270_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000144016.1|757269_757848_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000954195.1|757891_758464_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|758620_759109_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_001390260.1|759121_761929_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333498.1|761915_762071_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_000665305.1|762079_762445_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000290443.1|762499_763012_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000005414.1|763011_764196_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000132828.1|764353_765463_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000965749.1|765554_766637_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000019440.1|766981_767962_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000488099.1|768155_768416_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|768606_768747_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|769048_769348_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|769352_771740_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|771754_772738_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|773020_773065_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|773187_773544_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|773596_773794_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|773890_774433_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144190.1|774436_776365_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001142445.1|778962_779070_+	hypothetical protein	NA	NA	NA	NA	NA
776989:777005	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
WP_000771396.1|779122_779881_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251735.1|780167_781097_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|781197_781488_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267645.1|781593_782454_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|782494_783031_-	YniB family protein	NA	NA	NA	NA	NA
WP_000106834.1|783177_783846_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|784008_784599_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010722.1|784731_786123_+	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_000019440.1|786388_787369_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 4
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	888468	979486	5277336	holin,terminase,head,capsid,portal,tail,protease,tRNA	Enterobacteria_phage(34.78%)	108	NA	NA
WP_000984517.1|888468_889350_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|889541_891590_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|891609_892308_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|892404_892902_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|893031_894315_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|894283_896917_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|896996_898436_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|898553_898790_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|898894_899086_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812712.1|899086_899743_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|900138_900480_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|900492_901365_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|901368_901743_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|901881_902112_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|902213_902870_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|902893_903556_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|903552_905613_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|905821_906481_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|906807_907164_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|907230_907521_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|907654_908833_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|908888_909530_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|909566_911378_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|911612_913088_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056706.1|913425_914295_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|914422_915865_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|915995_916967_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|917086_918409_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|918424_919357_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|919435_920191_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|920187_920973_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|921119_922130_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|922138_922750_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|922888_922954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|923024_923627_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|923628_924150_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|924184_924925_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|924953_925406_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|925398_927171_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|927480_928047_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|928401_928650_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_071827722.1|928785_929046_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000227779.1|929188_929797_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	2.2e-37
WP_001387718.1|929805_931344_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.8e-54
WP_001228314.1|931495_932095_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515718.1|932162_935558_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000090891.1|935618_936251_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140762.1|936187_936931_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_001152522.1|936935_937634_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847391.1|937633_937963_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
WP_000081812.1|937959_940572_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
WP_000533444.1|940552_940966_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
WP_000479035.1|940992_941415_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
WP_000235108.1|941428_942181_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.5e-133
WP_000683079.1|942188_942584_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975010.1|942580_943156_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_001204556.1|943170_943524_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000201501.1|943516_943900_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522601.1|943951_944980_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000256823.1|945037_945385_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253973.1|945421_946927_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
WP_000831738.1|946916_948509_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_000259002.1|948505_948712_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390579.1|948695_950624_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000867568.1|950595_951144_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001329960.1|951538_951724_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|951856_951997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587457.1|952409_952595_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_001280932.1|952817_952949_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151822.1|952963_953146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092910.1|953302_953836_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_000551290.1|953964_954279_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_000731196.1|954288_955095_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000284510.1|955099_955315_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874354.1|955465_957319_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
WP_000935520.1|958110_959160_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_000917724.1|959311_959515_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|959779_960706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|960692_961241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|961253_961595_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001390267.1|961612_962602_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001072672.1|962609_963425_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
WP_000767110.1|963587_963983_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210143.1|963979_964306_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000066917.1|964302_964956_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001387484.1|964955_965450_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000061508.1|965446_966265_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_000620687.1|966261_966486_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_001087340.1|966482_967628_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000526669.1|967624_968182_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001191669.1|968174_968435_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001387485.1|968532_969225_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_000179185.1|969927_970290_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_000081306.1|970355_971180_+	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000008178.1|971307_971844_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|971834_972197_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|972193_972397_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_000476208.1|972389_972629_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
WP_000065512.1|972625_973174_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000628772.1|973687_974446_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000457723.1|974530_974773_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|974776_974923_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|974931_975168_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362003.1|975223_976534_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_044713004.1|976515_977286_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|977338_977734_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|977774_978518_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|978514_979486_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	1277448	1286890	5277336		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|1277448_1278585_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|1278581_1280582_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|1280706_1281168_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1281208_1281679_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1281725_1282445_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1282441_1284127_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1284348_1285080_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1285139_1285247_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1285227_1285959_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|1285963_1286890_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	1487618	1552650	5277336	terminase,integrase,head,transposase,portal,protease,tRNA	Enterobacteria_phage(45.95%)	68	1517423:1517439	1555103:1555119
WP_001283590.1|1487618_1488431_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|1488430_1489444_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699126.1|1489509_1490646_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
WP_000615821.1|1490744_1491740_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|1491736_1492915_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1493198_1494419_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683791.1|1494577_1496584_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|1496704_1496983_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|1497016_1497565_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|1497564_1498374_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043820.1|1498373_1499198_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|1499201_1500287_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|1500321_1501254_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730807.1|1501419_1501971_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|1502164_1503145_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387754.1|1503371_1504244_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|1504230_1504755_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|1504751_1505222_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|1505218_1505767_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|1505741_1506494_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112829.1|1506513_1509156_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|1509237_1509801_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|1510475_1510961_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426166.1|1511163_1513308_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531990.1|1513307_1514618_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|1514797_1515082_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|1515453_1516794_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937848.1|1517159_1518218_+	hypothetical protein	NA	NA	NA	NA	NA
1517423:1517439	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|1518399_1519155_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|1519448_1520381_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958672.1|1520692_1521850_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
WP_000178979.1|1522078_1523989_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000129924.1|1524059_1526039_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000835342.1|1526139_1527018_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000865490.1|1527250_1527391_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283829.1|1527496_1527748_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000820795.1|1527744_1528059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749286.1|1528084_1528570_+	lipoprotein	NA	NA	NA	NA	NA
WP_001387755.1|1528584_1530429_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000246924.1|1530428_1531895_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_000964882.1|1531904_1532597_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614045.1|1532599_1533055_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000785547.1|1533054_1533903_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_001122379.1|1533902_1535321_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000246749.1|1535329_1535812_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_000375637.1|1535786_1535972_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_001133485.1|1536014_1537286_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000426730.1|1537297_1538182_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_000852341.1|1538195_1540322_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_000200769.1|1540324_1541737_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000113732.1|1541733_1542174_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|1542176_1542419_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000638547.1|1543465_1543597_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|1543581_1543734_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|1543809_1543980_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|1543990_1544596_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951329.1|1544595_1544979_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_001111299.1|1545002_1545299_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_032159494.1|1545318_1545600_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214454.1|1545596_1545764_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000034245.1|1545760_1546432_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_000951713.1|1546794_1547004_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208008.1|1547000_1547630_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_001277767.1|1547726_1547906_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|1548037_1548238_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|1548767_1550015_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|1550086_1551001_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|1551216_1552650_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
1555103:1555119	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	1913252	1920392	5277336		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1913252_1915814_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141316.1|1915919_1916576_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001297141.1|1916626_1917394_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1917589_1918498_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1918494_1919757_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1919753_1920392_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	2152212	2210307	5277336	integrase,tRNA,protease,transposase	Staphylococcus_phage(18.18%)	45	2153197:2153214	2198135:2198152
WP_000701841.1|2152212_2152971_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105559.1|2153176_2154097_-	agmatinase	NA	NA	NA	NA	NA
2153197:2153214	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758915.1|2154232_2154964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2155109_2157086_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2157094_2157226_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2157361_2157577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2157880_2159035_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2159470_2160865_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|2160941_2161439_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2161533_2162241_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|2162320_2163052_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2163064_2164015_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2164123_2164687_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2164686_2165103_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001349546.1|2165278_2166259_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2166276_2166981_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2166998_2167565_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2167561_2167852_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|2167859_2168453_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|2168445_2169582_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|2169736_2170744_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|2170860_2171907_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2172082_2172802_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2172985_2173312_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2173311_2174031_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|2174191_2175244_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2175271_2175547_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|2175611_2176691_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|2176892_2178149_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839766.1|2178198_2180334_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2180731_2181439_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218809.1|2181817_2183080_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001387038.1|2184330_2184594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286652.1|2186063_2188913_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_001273465.1|2188938_2189919_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000126413.1|2189928_2192316_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000105162.1|2192325_2193954_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000081335.1|2193956_2196827_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001091149.1|2196915_2197209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254936.1|2197548_2198700_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
2198135:2198152	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_001189118.1|2199862_2201371_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001309734.1|2207186_2207621_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|2207617_2207968_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|2207998_2209612_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_077577697.1|2209944_2210307_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
>prophage 9
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	3021610	3051696	5277336	tRNA,integrase,transposase	Escherichia_phage(27.27%)	24	3035874:3035903	3057748:3057777
WP_001070193.1|3021610_3022300_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678443.1|3022305_3024387_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468836.1|3024552_3025758_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|3026037_3027429_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|3027549_3029259_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702903.1|3029311_3031630_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|3031639_3033022_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|3033708_3034893_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_000656307.1|3035742_3035832_-	acetyltransferase	NA	NA	NA	NA	NA
3035874:3035903	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|3035898_3038865_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3038867_3039428_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3039553_3039904_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|3040106_3041120_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|3041277_3041751_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|3041980_3042328_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|3042321_3043101_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|3043134_3043839_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3044338_3045199_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|3045796_3046501_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|3047256_3048108_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|3048415_3049231_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3049291_3050095_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3050094_3050931_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|3050991_3051696_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3057748:3057777	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 10
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	3607692	3666071	5277336	integrase,tRNA,protease,transposase	Enterobacteria_phage(33.33%)	29	3609859:3609873	3667353:3667367
WP_001295074.1|3607692_3609210_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856837.1|3609446_3610904_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	5.2e-48
3609859:3609873	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|3610962_3613110_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|3613189_3614524_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|3614889_3616428_-	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_001290187.1|3617176_3618019_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772029.1|3618103_3618301_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761715.1|3618320_3618809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094430.1|3618805_3619183_-	toxin	NA	NA	NA	NA	NA
WP_001285620.1|3619229_3619607_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692350.1|3619686_3619908_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000855057.1|3620485_3620959_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.1e-12
WP_001189118.1|3622894_3624403_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001045650.1|3625130_3629249_+|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_001390760.1|3630409_3631534_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_162886171.1|3632111_3633324_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_000555385.1|3633364_3634507_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001387604.1|3635246_3636173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074478.1|3636122_3637316_-	MFS transporter	NA	NA	NA	NA	NA
WP_001387605.1|3637451_3639176_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287497.1|3639176_3640124_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015710.1|3640123_3641866_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750143.1|3641862_3643200_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001387241.1|3643205_3645401_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001189118.1|3646365_3647874_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000422750.1|3649559_3649985_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_000291751.1|3653883_3654465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034110.1|3654511_3658369_-|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_001218804.1|3664808_3666071_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
3667353:3667367	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 11
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	3705750	3764294	5277336	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312490.1|3705750_3707010_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3707012_3708017_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3708098_3708296_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3708399_3709698_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3709902_3710328_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3710366_3712808_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|3712987_3713719_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|3713845_3714247_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|3714265_3714964_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|3715014_3715674_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000101644.1|3716099_3716738_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|3716740_3717904_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|3717987_3719613_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3719729_3720005_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|3720153_3720483_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|3720664_3721414_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|3721410_3722166_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|3722273_3723338_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|3723692_3725090_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|3725105_3725411_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|3725420_3725885_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|3725898_3726549_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|3726558_3727413_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|3727412_3728099_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|3728195_3728747_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|3728821_3729097_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|3729423_3729819_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|3729825_3730140_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3730144_3730372_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|3730413_3730863_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|3730933_3731728_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|3732350_3732782_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|3732789_3733998_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|3734132_3734771_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|3734989_3735610_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|3735918_3737331_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|3737375_3738038_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|3738145_3739111_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|3739218_3740079_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|3740167_3740548_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589423.1|3740676_3742620_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|3742809_3743550_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|3743539_3744097_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|3744421_3744628_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|3744689_3746033_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|3746355_3746994_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|3747199_3748933_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060946.1|3748929_3752709_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|3752711_3753053_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|3753264_3753516_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|3753509_3753860_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055072.1|3753939_3754470_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3754779_3755736_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205794.1|3756045_3757548_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001387274.1|3757561_3758584_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|3758570_3759566_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3759598_3760597_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219816.1|3760772_3762146_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3762296_3762848_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|3762941_3764294_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 12
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	3775565	3837499	5277336	holin,tRNA,integrase,transposase	Enterobacteria_phage(25.0%)	56	3767687:3767702	3807161:3807176
3767687:3767702	attL	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_000399648.1|3775565_3776546_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|3776822_3777209_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3777281_3777743_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013042.1|3777755_3778691_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
WP_001296693.1|3778694_3778829_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|3779109_3779505_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|3779635_3780349_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256656.1|3780419_3781013_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|3781157_3781610_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_001387612.1|3781732_3783052_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001387613.1|3783063_3783294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|3783394_3784399_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3784560_3784977_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059422.1|3785022_3785526_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079641.1|3785718_3786915_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416381.1|3786970_3789826_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|3789825_3790269_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3790402_3791914_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3792180_3793281_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3793280_3794363_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294559.1|3794481_3795984_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
WP_001349989.1|3796061_3797060_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|3797126_3798446_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|3798510_3799275_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197416.1|3799298_3800330_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896735.1|3800546_3801110_+	gluconokinase	NA	NA	NA	NA	NA
WP_000061766.1|3801113_3802133_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_000142493.1|3802562_3803489_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001223819.1|3803478_3805098_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001143292.1|3806398_3806692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202281.1|3807059_3807932_-	HNH endonuclease	NA	NA	NA	NA	NA
3807161:3807176	attR	AGAACAGGTTATCCAC	NA	NA	NA	NA
WP_001178761.1|3808176_3808557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099275.1|3810227_3810524_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001104341.1|3811153_3812230_+	Fic family protein	NA	NA	NA	NA	NA
WP_000729465.1|3812280_3812910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114712.1|3813820_3814645_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351184.1|3814810_3816367_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000859648.1|3816366_3817056_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001215044.1|3817167_3817332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416151.1|3819301_3820333_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|3820603_3821047_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705930.1|3821062_3821350_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|3821362_3822619_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001327567.1|3822865_3823120_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
WP_000107474.1|3823541_3824555_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998350.1|3824566_3825883_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3825910_3826831_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|3827136_3827919_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080200.1|3829102_3830716_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|3830746_3831097_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3831093_3831519_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001422798.1|3831657_3831786_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145474.1|3831966_3832623_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|3832868_3834146_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|3834208_3836206_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|3836359_3837499_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 13
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	4147674	4210000	5277336	plate,tRNA,protease,transposase	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001346129.1|4147674_4149027_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4149056_4151489_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4151610_4152096_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4152099_4153125_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4153229_4153685_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4153688_4154477_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4154476_4155625_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4155621_4156218_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4156254_4159737_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4159749_4160709_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4160807_4162949_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4163005_4163395_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|4163459_4164758_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4164806_4165067_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4165053_4165254_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4165419_4165965_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4165961_4166384_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|4166397_4167108_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|4167357_4168338_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260716.1|4169417_4171136_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4171247_4171955_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4171951_4172356_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4172473_4173289_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4173328_4173982_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4173974_4175006_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|4175193_4175766_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997043.1|4181663_4182467_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648601.1|4182463_4183378_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4183618_4184419_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|4184496_4185267_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4185314_4186673_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|4186744_4187500_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|4187533_4188256_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|4188252_4188720_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4188784_4189516_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4190051_4190837_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4190973_4191453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4191462_4192377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284200.1|4192420_4192903_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|4192926_4194279_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122987046.1|4194289_4197724_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240544.1|4197832_4199248_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|4199252_4199996_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614396.1|4199992_4202752_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000343303.1|4202760_4203522_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|4203526_4204858_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4204860_4205385_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|4205381_4206662_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4206686_4207769_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393853.1|4207732_4209583_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611748.1|4209586_4210000_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 14
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	4778074	4820508	5277336	integrase,head,capsid,portal,tail,lysis	Enterobacteria_phage(58.82%)	55	4776352:4776367	4799503:4799518
4776352:4776367	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|4778074_4779145_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|4779122_4779341_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|4779380_4779548_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120064.1|4779790_4780393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|4780603_4780825_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000188870.1|4780923_4781139_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548541.1|4781215_4781407_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000682318.1|4781379_4781562_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|4781558_4782239_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|4782235_4783021_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|4783026_4783323_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|4783398_4783605_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|4784202_4784892_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4784997_4785228_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|4785297_4785837_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_000147903.1|4785833_4786853_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_000788812.1|4786849_4787551_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000145901.1|4787547_4787850_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000338663.1|4789001_4789241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|4789817_4790069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072147432.1|4790165_4790267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|4790263_4790719_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|4790718_4790889_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|4790881_4791172_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000971074.1|4791526_4791667_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|4791752_4792136_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737263.1|4792324_4793407_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|4793995_4794211_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135297.1|4794210_4794708_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000092234.1|4794704_4795142_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001028465.1|4795346_4795868_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|4796217_4796628_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|4796684_4796918_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|4797306_4797852_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000198149.1|4799747_4799954_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
4799503:4799518	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_001316944.1|4799950_4801552_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123216.1|4801532_4802852_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001299443.1|4802861_4803194_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|4803249_4804275_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|4804316_4804712_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|4804723_4805077_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4805088_4805667_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|4805663_4806059_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390429.1|4806066_4806807_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479200.1|4806822_4807245_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_000459457.1|4807226_4807661_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840297.1|4807653_4810215_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
WP_000847379.1|4810211_4810541_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152576.1|4810540_4811239_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000140717.1|4811244_4811988_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_000090917.1|4811924_4812557_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515639.1|4812617_4816115_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233090.1|4816185_4816785_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001387657.1|4816849_4819924_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885623.1|4819923_4820508_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 15
NZ_CP023535	Escherichia coli strain FDAARGOS_403 chromosome, complete genome	5277336	5085426	5148804	5277336	bacteriocin,holin,terminase,capsid,portal,tail,lysis	Escherichia_phage(93.06%)	73	NA	NA
WP_000013658.1|5085426_5086737_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
WP_001208773.1|5086789_5087074_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497815.1|5087119_5087371_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
WP_000994790.1|5087735_5088089_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
WP_001291842.1|5088124_5088337_-	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000163446.1|5088296_5088923_-	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_000809302.1|5088919_5089351_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000203831.1|5089406_5090045_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
WP_000206786.1|5090400_5091297_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_001014298.1|5091299_5091491_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|5091492_5091900_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000206047.1|5091896_5092622_-	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_001159715.1|5092772_5093168_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000080417.1|5093244_5094066_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|5094129_5094477_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|5094551_5095139_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|5095138_5095828_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|5095824_5096775_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|5096791_5097073_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|5097093_5097375_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|5097386_5097599_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_001369605.1|5097669_5098344_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|5098599_5099385_-	Rha family phage regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|5100001_5100955_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|5100951_5102421_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|5102515_5103229_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|5103324_5103528_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|5103698_5103893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|5104059_5104437_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|5104430_5105951_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|5105940_5106912_+	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|5106911_5107361_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|5107368_5107932_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|5107928_5108123_+	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|5108115_5108550_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|5108798_5108951_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000649753.1|5109333_5110293_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5110304_5110574_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874432.1|5111059_5112997_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000143458.1|5113133_5113313_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5113353_5113599_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|5113676_5113892_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087737.1|5113896_5114430_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001056879.1|5114703_5115273_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000455397.1|5115272_5115422_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_024017835.1|5115424_5115862_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_001109019.1|5116064_5116616_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_001086073.1|5116908_5117715_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|5117695_5119402_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|5119401_5121546_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|5121703_5122711_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|5122734_5123949_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|5124004_5124394_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|5124443_5124905_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|5124888_5125452_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207927.1|5125451_5126102_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000117967.1|5126098_5128291_+|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000513231.1|5128377_5128890_+	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_001391593.1|5129123_5130749_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|5130745_5132014_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|5132028_5132307_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|5132312_5132930_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|5133020_5133755_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|5133987_5134128_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|5134184_5134586_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509489.1|5134679_5135336_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|5135338_5135785_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|5135794_5136046_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012452.1|5136056_5137322_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000331685.1|5137391_5145773_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_001273658.1|5146704_5146878_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001326838.1|5146960_5148289_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028096.1|5148309_5148804_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 1
NZ_CP023534	Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence	108679	67545	77843	108679	transposase	Enterobacteria_phage(22.22%)	12	NA	NA
WP_000086153.1|67545_68229_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
WP_001310011.1|68305_68617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023383827.1|68613_69516_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|69934_70183_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|70179_70617_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457515.1|70616_71888_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000587689.1|72091_72718_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001245884.1|72714_73017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|73285_74146_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|74328_74886_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|75449_76712_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|76967_77843_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 1
NZ_CP023533	Escherichia coli strain FDAARGOS_403 plasmid unnamed2, complete sequence	75566	65127	72081	75566	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000205736.1|65127_65874_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139330.1|65928_66489_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001387845.1|66717_67152_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000624689.1|67148_67445_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_000381397.1|67757_69329_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624622.1|69348_69696_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|69695_70373_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000019440.1|71100_72081_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
