The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	367283	421997	4838098	tail,plate,holin,head,lysis,tRNA	Salmonella_phage(41.18%)	62	NA	NA
WP_000117870.1|367283_368684_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|368884_369346_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544852.1|369662_370877_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_001524705.1|371122_372556_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|372636_373839_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|374033_375326_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|375370_375619_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|375659_375899_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|375941_377099_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001524702.1|377061_380262_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.7	0.0e+00
WP_023139985.1|380388_380739_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|380787_380919_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_001224472.1|381339_381765_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_001033909.1|381861_382116_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001524723.1|382102_382597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001524722.1|382643_383651_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.0	1.7e-122
WP_157872077.1|383562_384105_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_000089415.1|384117_384513_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_023139984.1|384799_385930_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001237395.1|386326_388306_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|388994_389243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001524693.1|389305_389908_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	98.5	3.7e-109
WP_001096565.1|390116_390758_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.6	3.7e-115
WP_001524696.1|390754_390895_+	YlcG family protein	NA	H6WRZ0	Salmonella_phage	81.6	3.2e-08
WP_001524724.1|390891_391569_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.9	1.2e-58
WP_001522455.1|391841_392408_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	84.7	1.1e-54
WP_001522279.1|392536_393223_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	97.8	3.3e-130
WP_001574216.1|393498_393828_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984583.1|393811_394264_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_058671951.1|394281_394734_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.0	8.5e-66
WP_001113128.1|394958_395141_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_058671947.1|395211_395841_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	3.0e-109
WP_043987213.1|395843_397463_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	83.1	1.8e-267
WP_058671948.1|397462_398983_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	6.3e-105
WP_000552015.1|399023_399713_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	48.7	1.0e-57
WP_000587352.1|399709_401056_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	1.1e-68
WP_001091402.1|401057_401540_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	5.8e-20
WP_001031914.1|401539_402568_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	8.7e-82
WP_080102635.1|402571_402919_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_016716089.1|402925_403372_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
WP_058671949.1|403365_403950_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	29.8	6.1e-16
WP_001048637.1|403946_404312_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|404296_404842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122277.1|404822_406307_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	6.8e-96
WP_000016414.1|406307_406754_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|406753_407158_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|407199_407382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753315.1|407365_409537_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_001525483.1|409533_410244_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
WP_000890115.1|410243_410546_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|410542_411412_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_058671950.1|411392_412070_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
WP_001191865.1|412082_412439_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|412435_413677_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181747.1|413678_414281_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_043986896.1|414882_415545_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	51.3	4.5e-39
WP_001525492.1|415551_415959_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	9.1e-59
WP_001525493.1|417090_417306_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.1e-26
WP_024135692.1|417611_417731_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	71.9	2.6e-06
WP_001525490.1|417809_418496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|418766_418958_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525494.1|419384_421997_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
>prophage 2
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	596261	632104	4838098	tail,integrase,holin,portal,tRNA	Salmonella_phage(45.45%)	42	588339:588352	602877:602890
588339:588352	attL	GATTTCAGCGGTAA	NA	NA	NA	NA
WP_001525316.1|596261_597368_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476069.1|597421_597883_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001525321.1|597894_598224_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249412.1|598220_598886_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|599057_600308_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
WP_000741325.1|600421_601564_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|601553_601790_-	excisionase	NA	NA	NA	NA	NA
WP_000008352.1|601932_602472_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	2.2e-97
WP_001525327.1|602608_603436_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.2	9.2e-151
602877:602890	attR	TTACCGCTGAAATC	NA	NA	NA	NA
WP_071586821.1|604097_604436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023262052.1|604373_604682_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_058671845.1|604890_605586_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.1	3.9e-126
WP_001191666.1|605683_605908_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509733.1|605936_606491_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	2.0e-101
WP_001525520.1|606630_606807_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.6	4.6e-28
WP_000147078.1|606825_607134_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	93.1	2.5e-45
WP_024131287.1|607123_607453_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	90.8	2.6e-40
WP_096753346.1|607471_608317_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	96.7	1.7e-144
WP_000620702.1|608313_608538_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_096753316.1|609266_609950_+|tail	phage tail tube protein	tail	Q8HAC2	Salmonella_phage	97.0	4.3e-69
WP_001525515.1|611412_611823_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	83.6	1.2e-58
WP_033578003.1|611919_612120_-	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000481981.1|614345_616448_+	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	48.5	1.0e-28
WP_000334552.1|616767_617439_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	8.2e-81
WP_010989045.1|618190_618559_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001525524.1|618587_619919_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.9	5.5e-20
WP_023219695.1|620215_620551_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	95.5	7.7e-56
WP_171903195.1|620708_620915_+	hypothetical protein	NA	Q8HAD6	Salmonella_phage	87.9	1.1e-20
WP_000605609.1|620926_621109_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_058671848.1|621108_622350_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.5	4.5e-242
WP_000143178.1|623315_623897_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_044811092.1|624093_624816_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001525277.1|625028_625247_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	88.2	3.0e-24
WP_001525275.1|625417_625837_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.8	1.3e-36
WP_001525281.1|625839_627108_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.3	8.3e-244
WP_001525273.1|627100_627772_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	6.9e-80
WP_001525283.1|628174_628873_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	2.1e-87
WP_023237793.1|628958_629279_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	3.2e-19
WP_001525287.1|629323_630613_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.7	1.7e-167
WP_001525274.1|630625_631051_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.5e-51
WP_043986716.1|631443_631797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023234890.1|631936_632104_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	5.8e-20
>prophage 3
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	1282525	1291746	4838098	tail,integrase	Salmonella_phage(28.57%)	12	1286400:1286414	1297289:1297303
WP_001687735.1|1282525_1283026_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_001525042.1|1285130_1285622_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001525026.1|1285676_1285865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1285929_1286097_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|1286353_1286887_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
1286400:1286414	attL	CGTTCACACGTCATT	NA	NA	NA	NA
WP_001013467.1|1286940_1287171_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001525015.1|1287201_1288308_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	66.7	1.5e-55
WP_001525019.1|1288304_1289384_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	4.1e-98
WP_000722368.1|1289757_1290111_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979694.1|1290127_1291003_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1291003_1291378_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1291515_1291746_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
1297289:1297303	attR	CGTTCACACGTCATT	NA	NA	NA	NA
>prophage 4
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	1396008	1403276	4838098		Morganella_phage(33.33%)	8	NA	NA
WP_001157314.1|1396008_1397439_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_001524563.1|1397512_1398208_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
WP_072202292.1|1398287_1398599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080675.1|1399248_1400460_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_024131163.1|1400719_1400908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1400918_1401131_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_001524577.1|1401585_1402854_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	7.8e-226
WP_000394197.1|1402856_1403276_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	1470611	1514562	4838098	tail,plate,integrase,holin,terminase	Salmonella_phage(51.28%)	53	1504658:1504672	1518043:1518057
WP_000798891.1|1470611_1470878_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
WP_024138909.1|1470893_1471085_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_080086827.1|1471193_1471628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080086814.1|1471983_1472583_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.5	4.7e-88
WP_080086815.1|1472572_1473397_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	89.4	7.8e-142
WP_096753317.1|1473393_1475103_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	1.0e-90
WP_023136425.1|1475099_1475726_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.2	1.3e-91
WP_080086817.1|1475709_1476936_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	65.4	2.8e-151
WP_001261467.1|1476932_1477265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624581.1|1477261_1477978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080086818.1|1477974_1479018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624579.1|1479017_1479293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080086819.1|1479289_1480006_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	7.7e-29
WP_080086820.1|1480005_1482060_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	3.8e-20
WP_079788678.1|1482183_1482771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|1482770_1483208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018953.1|1483211_1484606_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	9.3e-71
WP_023225461.1|1484611_1485550_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.9	2.9e-52
WP_031604700.1|1485533_1485944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114360.1|1485961_1486387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643824.1|1486399_1486885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023239897.1|1486949_1487981_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.9e-73
WP_047658476.1|1487998_1488871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047658475.1|1488891_1490466_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	48.6	1.7e-20
WP_080086821.1|1490466_1491342_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	38.6	2.7e-39
WP_061595499.1|1491313_1492744_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.1	1.5e-92
WP_080086822.1|1492743_1494015_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	1.0e-84
WP_080086823.1|1494004_1494976_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	32.8	1.2e-24
WP_000877750.1|1495063_1495624_+	YfbU family protein	NA	NA	NA	NA	NA
WP_080086824.1|1495653_1496193_-	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	29.5	9.7e-08
WP_080086825.1|1496195_1496612_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	57.2	9.3e-43
WP_165801326.1|1496614_1496962_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	83.2	1.0e-47
WP_000764541.1|1497367_1498165_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	98.1	1.3e-149
WP_024134429.1|1498154_1498301_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	4.3e-19
WP_001096565.1|1498297_1498939_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.6	3.7e-115
WP_000929788.1|1499147_1499750_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_031606790.1|1499784_1500033_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	8.0e-42
WP_001217669.1|1500152_1500386_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_080086826.1|1501271_1501475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096753318.1|1501477_1502350_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	68.6	7.9e-52
WP_000113623.1|1502346_1502694_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|1502704_1503454_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001191964.1|1503456_1504518_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.0	3.3e-36
1504658:1504672	attL	TGTGGGTTGGCTGGA	NA	NA	NA	NA
WP_001574095.1|1504791_1505166_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000992434.1|1505131_1505368_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_079970734.1|1505472_1505868_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	71.0	1.3e-46
WP_048664102.1|1506454_1506964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551854.1|1508030_1508201_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	3.3e-07
WP_080086853.1|1508222_1508573_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_096753319.1|1508699_1511627_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	98.4	0.0e+00
WP_080086854.1|1511589_1512750_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	82.1	1.2e-180
WP_080086851.1|1512792_1513032_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_038395458.1|1513380_1514562_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	90.3	6.0e-212
1518043:1518057	attR	TCCAGCCAACCCACA	NA	NA	NA	NA
>prophage 6
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	1541402	1551908	4838098		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|1541402_1542716_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565903.1|1542742_1543822_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648784.1|1543826_1544600_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001523570.1|1544596_1545589_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|1545594_1546146_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_043985472.1|1546146_1547025_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	4.6e-108
WP_001023658.1|1547072_1547972_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|1547971_1549057_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001523554.1|1549433_1550327_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111838.1|1550504_1551908_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	1620185	1629356	4838098	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_001581095.1|1620185_1622219_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000703137.1|1622459_1622918_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_043985426.1|1623089_1623620_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950415.1|1623676_1624144_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_000598637.1|1624190_1624910_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|1624906_1626592_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|1626814_1627546_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|1627605_1627713_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|1627693_1628425_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|1628408_1629356_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	2037587	2140355	4838098	tail,integrase,holin,protease,portal,terminase,tRNA	Salmonella_phage(36.21%)	103	2051366:2051382	2155947:2155963
WP_000940032.1|2037587_2038319_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2038437_2039241_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001522385.1|2039385_2040264_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
WP_070793528.1|2040445_2041489_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2041492_2042311_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2042321_2043335_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_001522458.1|2043335_2044322_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2044312_2044951_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_001522449.1|2045076_2046354_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001522369.1|2046348_2047488_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_096753322.1|2047683_2048937_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.0e-100
WP_000883089.1|2049261_2050452_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2050633_2052178_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
2051366:2051382	attL	ACCAATTACCGGGTCAA	NA	NA	NA	NA
WP_000100008.1|2052538_2053870_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2053952_2056097_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_058671689.1|2056152_2057613_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	29.0	9.8e-47
WP_000717694.1|2057661_2058000_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2058076_2059414_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|2059410_2060175_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_134938741.1|2060176_2061607_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
WP_000970048.1|2062111_2065999_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.1e-128
WP_001667158.1|2066023_2066254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522527.1|2066254_2067799_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134567.1|2067849_2068401_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2068425_2069061_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361660.1|2069064_2070426_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048531.1|2070436_2071330_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001522296.1|2071445_2072294_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2072332_2073250_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001522371.1|2073271_2074468_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2074583_2075510_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196291.1|2075547_2075808_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001522310.1|2075919_2076300_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2076299_2077031_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2077042_2077771_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102230.1|2077782_2078688_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2078684_2079365_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2079638_2080613_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2080629_2082429_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_001522456.1|2082955_2086321_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.5	1.2e-311
WP_071586787.1|2086984_2087185_+	PagK	NA	NA	NA	NA	NA
WP_000143150.1|2087281_2087860_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	92.1	5.4e-97
WP_001522316.1|2087859_2090298_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.6e-89
WP_001522291.1|2090341_2093737_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	74.7	0.0e+00
WP_000246124.1|2093798_2094446_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_000662736.1|2094343_2095081_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	4.0e-129
WP_001522411.1|2095087_2095786_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	1.2e-103
WP_000447370.1|2095795_2096125_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001522417.1|2096127_2099169_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.2	7.0e-297
WP_077905595.1|2099140_2099479_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.3	4.6e-32
WP_000479607.1|2099475_2099871_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000861392.1|2099921_2100668_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.5	2.1e-98
WP_001032971.1|2100678_2101080_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	65.4	1.6e-47
WP_000053598.1|2101076_2101661_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.1	3.4e-75
WP_000002964.1|2101664_2101940_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
WP_001107911.1|2101932_2102256_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_086016036.1|2102344_2104459_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PGT6	Enterobacteria_phage	72.4	3.4e-274
WP_001009891.1|2104376_2105912_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	63.1	2.8e-177
WP_000196422.1|2105908_2106115_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_001522257.1|2106111_2108220_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.4	4.7e-292
WP_000348549.1|2108206_2108698_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	4.5e-44
WP_000744510.1|2109050_2109242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522361.1|2109296_2109800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522312.1|2109902_2110445_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001522502.1|2110441_2111068_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.2	3.0e-93
WP_085429533.1|2111070_2111412_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.3e-45
WP_001522279.1|2111687_2112374_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	97.8	3.3e-130
WP_001522455.1|2112502_2113069_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	84.7	1.1e-54
WP_001524724.1|2113341_2114019_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.9	1.2e-58
WP_001524696.1|2114015_2114156_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	81.6	3.2e-08
WP_043986276.1|2114152_2114794_-	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.1	7.0e-114
WP_070793545.1|2115002_2115605_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.1e-108
WP_000807548.1|2115687_2115909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525751.1|2116019_2116253_-	DinI family protein	NA	H6WRY5	Salmonella_phage	87.0	4.9e-33
WP_001525754.1|2116441_2117074_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	92.4	5.5e-103
WP_001525761.1|2117577_2117835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525753.1|2117834_2118626_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	72.8	8.8e-58
WP_000113624.1|2118622_2118970_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	99.1	1.3e-58
WP_001525762.1|2118980_2119730_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	94.8	3.2e-134
WP_001525759.1|2119732_2120710_-	replication protein	NA	H6WRX7	Salmonella_phage	94.7	2.6e-152
WP_000426366.1|2120800_2121121_-	transcriptional regulator	NA	A0A0M4RU01	Salmonella_phage	99.1	2.9e-52
WP_001555460.1|2121155_2121383_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2121488_2121923_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917561.1|2122219_2122378_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_077905645.1|2122399_2122750_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	77.6	4.3e-49
WP_070793544.1|2122872_2125788_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	89.4	0.0e+00
WP_077905217.1|2125750_2126908_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
WP_001237032.1|2126950_2127190_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_014344516.1|2127230_2127515_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001007935.1|2127492_2128722_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_001525211.1|2129219_2129699_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001525222.1|2129695_2130652_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2130651_2131302_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2131333_2131909_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2131905_2132070_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001525217.1|2132334_2133957_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083339.1|2133941_2134679_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2134808_2136143_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_077946441.1|2136160_2137060_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2137161_2137749_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2137810_2138194_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2138512_2139202_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2139317_2140355_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2155947:2155963	attR	ACCAATTACCGGGTCAA	NA	NA	NA	NA
>prophage 9
NZ_CP023512	Salmonella enterica subsp. enterica serovar Saintpaul strain FDAARGOS_373 chromosome, complete genome	4838098	2167063	2235436	4838098	tail,plate,integrase,holin,head,protease,capsid,portal,terminase,tRNA	Salmonella_phage(60.78%)	72	2196117:2196155	2235524:2235562
WP_000469813.1|2167063_2167831_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2167875_2168424_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2168442_2168691_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2169034_2170396_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2170561_2171353_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127908301.1|2171372_2172659_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_096753323.1|2172788_2173394_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001518875.1|2173428_2174019_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001525081.1|2174142_2175021_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001525072.1|2175106_2176768_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2176916_2177255_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112991.1|2177420_2177711_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242605.1|2177700_2178177_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2178326_2178809_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001525077.1|2179423_2190898_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533856.1|2190962_2192372_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001525075.1|2192368_2194549_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_010989057.1|2194556_2195720_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2196117:2196155	attL	AATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_138074579.1|2196614_2196941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753324.1|2197022_2197412_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	70.5	4.8e-49
WP_038642073.1|2197490_2197733_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_096753325.1|2198020_2198422_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.0e-59
WP_079972651.1|2198428_2199523_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	97.3	1.1e-55
WP_071646071.1|2199509_2200097_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.5	8.3e-114
WP_096753326.1|2200099_2201179_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	96.1	2.4e-199
WP_071646069.1|2201171_2201585_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	94.2	3.6e-71
WP_001273649.1|2201589_2202123_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_096753327.1|2202122_2203181_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_096753328.1|2203177_2204518_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	2.8e-250
WP_096753329.1|2204551_2206480_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	98.0	0.0e+00
WP_000588852.1|2206564_2206891_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2206887_2207244_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_096753330.1|2207243_2208740_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.4	5.2e-277
WP_000497739.1|2208729_2208894_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|2208897_2209458_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135697.1|2209454_2209967_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000776846.1|2209938_2210343_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	98.5	2.7e-71
WP_080096385.1|2210339_2210663_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	71.0	7.5e-40
WP_000766105.1|2210742_2211972_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.4	8.7e-206
WP_000003793.1|2211981_2212584_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077943548.1|2212597_2213671_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	84.4	2.3e-178
WP_153247003.1|2213783_2213945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257216.1|2213941_2215672_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	7.2e-198
WP_079810074.1|2215671_2216109_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	4.6e-32
WP_001135098.1|2216255_2216606_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2216656_2216989_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_057515947.1|2217451_2217844_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	99.2	1.1e-64
WP_001624504.1|2217840_2218455_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2218454_2218736_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2218722_2219109_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2219254_2219512_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2219662_2220415_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_096753347.1|2220428_2221418_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.7	3.6e-194
WP_001061463.1|2221425_2222226_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	72.2	1.1e-105
WP_023260361.1|2222242_2222632_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	86.0	1.9e-61
WP_023262048.1|2222628_2223282_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.5	1.6e-113
WP_023893158.1|2223281_2224184_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	95.1	3.9e-62
WP_000620702.1|2224180_2224405_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023262051.1|2224401_2225559_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	99.0	1.5e-215
WP_023196860.1|2225555_2226110_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	2.6e-101
WP_001749160.1|2226153_2226354_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	81.5	2.5e-22
WP_001749159.1|2226442_2227117_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.9	1.7e-115
WP_023262052.1|2227291_2227600_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
WP_071586821.1|2227537_2227876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|2228416_2228788_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001525327.1|2228845_2229673_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.2	9.2e-151
WP_023262053.1|2229809_2230334_+	bacteriophage protein	NA	A0A192Y8M4	Salmonella_phage	97.1	6.1e-92
WP_024150527.1|2230442_2231309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024145650.1|2231350_2231557_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	68.8	6.9e-23
WP_023262054.1|2231517_2232684_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	66.7	1.3e-145
WP_023262055.1|2232741_2234475_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023262056.1|2234554_2235436_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	22.5	2.7e-07
2235524:2235562	attR	AATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
