The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	532476	543386	3967822	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_006024809.1|532476_534777_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.3e-167
WP_006024808.1|534773_535088_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	45.8	1.2e-13
WP_004196460.1|535617_535821_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_015601231.1|535944_537543_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_006024806.1|537713_538973_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	8.9e-12
WP_006024805.1|539237_539816_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|540076_540295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601971.1|540487_540997_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	40.2	3.2e-13
WP_006024803.1|541271_543386_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.5	1.5e-56
>prophage 2
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	1543269	1551374	3967822	plate,portal	Burkholderia_virus(50.0%)	8	NA	NA
WP_015602062.1|1543269_1544175_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.7	7.2e-157
WP_041861800.1|1544171_1544534_-	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	85.0	1.0e-53
WP_075644724.1|1545744_1546200_-	hypothetical protein	NA	F2Y385	Organic_Lake_phycodnavirus	38.0	2.3e-18
WP_041861553.1|1547362_1548400_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.8	4.8e-197
WP_004202809.1|1548443_1548800_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_015600654.1|1549013_1550108_-	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	60.6	1.8e-93
WP_075644725.1|1550122_1550701_-	VRR-NUC domain-containing protein	NA	A4JX24	Burkholderia_virus	51.3	1.5e-46
WP_015600472.1|1550837_1551374_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	62.9	4.1e-59
>prophage 3
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	1777631	1823619	3967822	integrase,protease,plate,transposase	Liberibacter_phage(40.0%)	42	1773441:1773458	1827000:1827017
1773441:1773458	attL	CTCGGCGAGCGTCTCGGC	NA	NA	NA	NA
WP_015600083.1|1777631_1778135_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.9	8.4e-22
WP_015601523.1|1778427_1779630_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	49.6	1.3e-105
WP_015601576.1|1779637_1780489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051139159.1|1780424_1781636_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_075644734.1|1782065_1783553_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_015601012.1|1783710_1784001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600837.1|1784049_1784322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602378.1|1784318_1784528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601042.1|1785578_1786634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601496.1|1786794_1788576_-	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	32.4	7.3e-52
WP_015601331.1|1788763_1789093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015600692.1|1789458_1790064_+	putative lipoprotein	NA	NA	NA	NA	NA
WP_096746686.1|1790065_1790680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110407.1|1790750_1791044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601920.1|1791470_1792112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602002.1|1792113_1792413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600590.1|1792523_1793330_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_015601312.1|1793398_1794475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601601.1|1794471_1795377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601628.1|1795432_1795660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601499.1|1795672_1796668_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	39.1	2.0e-51
WP_041861811.1|1796745_1797711_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.5	5.0e-55
WP_006029871.1|1797802_1798918_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_075644940.1|1799073_1799355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600937.1|1800053_1800251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602385.1|1800247_1801750_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	53.9	9.8e-151
WP_041861812.1|1801839_1803378_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.1	1.8e-139
WP_096746687.1|1803415_1804573_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	37.6	1.1e-21
WP_015601397.1|1804562_1807547_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	40.8	1.3e-210
WP_015601243.1|1807556_1810418_+	PHP domain protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.9	1.5e-14
WP_015601963.1|1810419_1811688_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_011883089.1|1812466_1812952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602426.1|1812963_1814097_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_006029380.1|1814637_1815423_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006029381.1|1815419_1816766_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_015600452.1|1816874_1817489_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_015601514.1|1817862_1818528_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006029385.1|1818564_1819083_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006029386.1|1819100_1820591_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006029387.1|1820663_1821167_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_015601561.1|1821218_1821701_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_015600388.1|1821780_1823619_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
1827000:1827017	attR	GCCGAGACGCTCGCCGAG	NA	NA	NA	NA
>prophage 4
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	2136053	2145228	3967822		Hokovirus(16.67%)	7	NA	NA
WP_015601574.1|2136053_2137994_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	8.5e-147
WP_015601848.1|2138257_2139391_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.2	9.1e-24
WP_015602361.1|2139422_2141384_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.3	3.8e-54
WP_006025369.1|2141549_2142365_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.1	9.7e-36
WP_015602420.1|2142429_2143113_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	6.7e-06
WP_006025371.1|2143109_2143637_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_015602021.1|2143674_2145228_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 5
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	2501822	2510257	3967822		Bacillus_phage(16.67%)	8	NA	NA
WP_015600060.1|2501822_2503223_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.2e-78
WP_015601685.1|2503254_2504178_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	5.7e-16
WP_006025721.1|2504236_2505229_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	1.0e-26
WP_015601656.1|2505300_2505618_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009916396.1|2505956_2506859_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	2.3e-54
WP_015601716.1|2506953_2508180_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006025725.1|2508358_2509282_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	2.4e-43
WP_041861829.1|2509402_2510257_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.4	3.3e-18
>prophage 6
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	2933868	3035552	3967822	integrase,portal,head,capsid,protease,terminase,tRNA,tail	Ralstonia_phage(28.21%)	107	2974554:2974581	3021891:3021918
WP_041861634.1|2933868_2934453_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.3	2.2e-05
WP_015601805.1|2934506_2935448_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_006026108.1|2935771_2936467_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075644797.1|2936580_2938113_+	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_015600169.1|2938123_2938936_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_015601713.1|2939081_2940035_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_015600525.1|2940034_2940556_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_006026113.1|2940679_2941693_+	allantoicase	NA	NA	NA	NA	NA
WP_015601651.1|2941689_2942202_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_015600419.1|2942409_2943774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600367.1|2944164_2945367_-	urate hydroxylase PuuD	NA	NA	NA	NA	NA
WP_009912807.1|2945416_2945770_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_015600161.1|2946267_2947680_+	8-oxoguanine deaminase	NA	A0A291ATQ6	Pandoravirus	24.4	1.5e-07
WP_006026119.1|2947874_2948804_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009912804.1|2949312_2949522_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_041861635.1|2949612_2950551_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004191671.1|2950709_2951153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192898.1|2951520_2951952_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015600473.1|2952136_2953345_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006026123.1|2953457_2954138_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_075644986.1|2954407_2954701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600999.1|2954653_2957176_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_015601734.1|2957384_2957834_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_015601864.1|2958275_2959307_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_006026127.1|2959374_2960592_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_015600564.1|2960909_2961104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170963095.1|2961233_2964803_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_015600386.1|2964824_2965535_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_006026131.1|2965575_2966064_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_006026132.1|2966255_2966783_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_009912787.1|2966860_2967409_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_015600436.1|2967606_2968965_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004199523.1|2969057_2969783_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	36.7	8.1e-34
WP_009904927.1|2969870_2970053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601254.1|2970052_2970343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601607.1|2972106_2973360_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_006026138.1|2973418_2974255_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
2974554:2974581	attL	GCCGGTTCGAGTCCGGCCTCACGCACCA	NA	NA	NA	NA
WP_009941357.1|2974743_2975760_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	39.8	9.6e-49
WP_015600418.1|2975993_2976314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600944.1|2976313_2976583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600229.1|2976596_2977313_-	hypothetical protein	NA	C7BGD6	Burkholderia_phage	47.1	6.7e-57
WP_015600604.1|2977621_2981023_-	host specificity protein J	NA	Q3HQU5	Burkholderia_phage	57.1	0.0e+00
WP_041861638.1|2981019_2981595_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	50.3	1.9e-46
WP_015602451.1|2981591_2982332_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	54.8	3.3e-75
WP_015600135.1|2982328_2983009_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	53.1	1.7e-62
WP_015601347.1|2983958_2984303_-|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	40.7	3.7e-13
WP_041861639.1|2984299_2987113_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	22.7	1.8e-20
WP_075644802.1|2987109_2987553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041861641.1|2987883_2988219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601485.1|2988367_2988805_-|tail	phage major tail 2 family protein	tail	NA	NA	NA	NA
WP_015601472.1|2988804_2989161_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_075644803.1|2989153_2989492_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_015600215.1|2989524_2989815_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_015600130.1|2989807_2991145_-|portal	phage portal protein	portal	A0A0R6PHI5	Moraxella_phage	43.6	4.3e-81
WP_015602462.1|2991141_2991312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015600962.1|2991371_2992706_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	41.4	3.1e-79
WP_075644804.1|2992719_2993358_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	42.9	7.9e-33
WP_015601176.1|2993320_2994910_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	65.1	6.5e-185
WP_075644989.1|2994906_2995383_-	TerS protein	NA	A0A0F7L441	uncultured_marine_virus	48.7	1.5e-28
WP_041861642.1|2996220_2996703_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_167359309.1|2996977_2997274_-	HNH endonuclease	NA	D4FUN2	Pseudomonas_phage	48.4	4.9e-06
WP_138110425.1|2997528_2997927_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_015601215.1|2997975_2998620_-	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	28.8	9.7e-15
WP_138110427.1|2999088_2999535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600095.1|2999752_3000478_+	phage antirepressor KilAC domain-containing protein	NA	B3VGL7	Mycobacterium_virus	50.3	1.4e-33
WP_015600721.1|3000531_3000765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600873.1|3001113_3001740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051139202.1|3002159_3002366_+	hypothetical protein	NA	B5BTU9	Ralstonia_phage	74.6	4.2e-20
WP_015600868.1|3002664_3003036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600811.1|3003035_3003287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601324.1|3003303_3003591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600725.1|3003587_3003794_+	Fragile-X-F family protein	NA	NA	NA	NA	NA
WP_015602193.1|3004061_3004634_+	toprim domain-containing protein	NA	A0A077KVN4	Ralstonia_phage	52.7	1.3e-47
WP_041861643.1|3004749_3006045_+	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	61.1	2.2e-151
WP_075644806.1|3006041_3006461_+	HNH endonuclease	NA	A0A0P0ICV0	Acinetobacter_phage	44.4	7.5e-24
WP_015602131.1|3006457_3006610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600078.1|3006606_3006879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602147.1|3006981_3007890_+	ATP-dependent DNA ligase	NA	A0A068Q5W4	Ralstonia_phage	48.1	1.5e-66
WP_015601257.1|3008056_3008617_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	49.4	3.5e-37
WP_015601949.1|3008663_3011060_+	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	64.6	1.4e-300
WP_015600626.1|3011080_3011911_+	hypothetical protein	NA	A0A077KTI9	Ralstonia_phage	55.9	1.7e-64
WP_015601124.1|3011910_3012126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600772.1|3012284_3013058_+	phosphodiesterase I	NA	A0A1L7DQH5	Ralstonia_phage	52.0	1.8e-68
WP_102812144.1|3013059_3013419_+	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	58.6	6.4e-24
WP_015600542.1|3013415_3014204_+	ribonuclease H-like domain-containing protein	NA	A0A2P0VPF6	Ralstonia_phage	66.2	1.4e-100
WP_015602387.1|3014213_3014804_+	DNA polymerase III subunit beta, central domain protein	NA	A0A1L7DQD4	Ralstonia_phage	40.5	2.8e-24
WP_041861645.1|3014927_3015155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861845.1|3015288_3015591_+	hypothetical protein	NA	D2EBS7	Pseudomonas_phage	71.1	1.9e-29
WP_015602143.1|3015587_3015779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600150.1|3017063_3019373_+	DNA-dependent RNA polymerase	NA	A0A2R2ZGE5	Ralstonia_phage	31.4	2.9e-77
WP_041861646.1|3019451_3020288_+	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	59.0	5.0e-80
WP_009941408.1|3020373_3020565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602186.1|3020596_3020854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167359286.1|3020887_3021115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861647.1|3021065_3021611_-	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	44.2	2.5e-27
WP_015600769.1|3022373_3022835_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
3021891:3021918	attR	GCCGGTTCGAGTCCGGCCTCACGCACCA	NA	NA	NA	NA
WP_015600742.1|3022929_3023553_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	31.7	1.4e-18
WP_015601389.1|3023753_3024863_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	30.3	7.8e-36
WP_015601595.1|3024911_3026105_-	MFS transporter	NA	NA	NA	NA	NA
WP_015601149.1|3026128_3027190_-	porin	NA	NA	NA	NA	NA
WP_015602064.1|3027523_3028669_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015600775.1|3028751_3029741_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_006026146.1|3029822_3030272_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064483019.1|3030362_3031526_-	glycerate kinase	NA	NA	NA	NA	NA
WP_015602421.1|3031973_3033323_+	trigger factor	NA	NA	NA	NA	NA
WP_006026149.1|3033467_3034121_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.0	1.1e-53
WP_004521258.1|3034280_3035552_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	2.4e-134
>prophage 7
NZ_CP023499	Burkholderia thailandensis strain FDAARGOS_426 chromosome 1, complete sequence	3967822	3413930	3456346	3967822	portal,plate,capsid,head,holin,transposase,terminase,tail,lysis	Burkholderia_virus(54.35%)	54	NA	NA
WP_015602418.1|3413930_3414290_+	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	81.5	2.1e-51
WP_015600260.1|3414617_3414947_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	92.7	1.2e-53
WP_041861674.1|3415319_3416189_+	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	71.8	1.4e-104
WP_015601415.1|3416185_3416686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015601027.1|3416716_3416902_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	90.2	8.3e-20
WP_009897093.1|3416898_3417120_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_006027274.1|3417347_3417485_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	97.8	6.2e-20
WP_006027273.1|3417642_3417861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015600181.1|3418113_3419430_+	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	37.6	2.0e-67
WP_015600741.1|3421406_3423200_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	92.0	0.0e+00
WP_015600468.1|3423215_3423482_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	95.3	8.6e-42
WP_004532731.1|3423478_3423685_+	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	100.0	8.7e-34
WP_015601099.1|3423774_3424428_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	99.5	1.2e-113
WP_041861677.1|3424661_3424784_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	97.5	2.9e-13
WP_015600440.1|3424887_3425421_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	96.0	5.6e-93
WP_015601730.1|3425417_3426155_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	96.3	5.2e-129
WP_041861678.1|3426169_3427285_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	97.8	4.6e-214
WP_015600678.1|3427968_3428265_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	1.6e-49
WP_004202809.1|3428267_3428624_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_015600601.1|3428667_3429723_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	97.7	1.6e-203
WP_015602129.1|3429719_3431489_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	98.5	0.0e+00
WP_015600790.1|3431682_3432120_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082252628.1|3432126_3432651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075644826.1|3432724_3433321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_138110445.1|3433362_3433686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602349.1|3434167_3434977_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	98.5	1.1e-145
WP_015601766.1|3435010_3436024_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	96.1	3.8e-183
WP_015600205.1|3436020_3436710_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	99.1	1.0e-115
WP_015602371.1|3436809_3437289_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	97.5	5.4e-79
WP_015601733.1|3437288_3437540_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	98.8	1.7e-39
WP_004524438.1|3437536_3437743_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004553021.1|3437757_3438102_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	6.5e-50
WP_015602400.1|3438103_3438376_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	98.9	2.5e-41
WP_015600152.1|3438372_3439185_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.1	1.4e-148
WP_015600594.1|3439181_3439622_+|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	91.8	1.8e-65
WP_015601830.1|3439726_3440143_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	96.4	2.0e-69
WP_015600143.1|3440139_3440607_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.8	5.1e-74
WP_015602435.1|3441617_3442421_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	96.5	5.3e-143
WP_015601241.1|3442594_3443275_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	96.5	3.4e-119
WP_015600511.1|3443271_3443634_+	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	95.0	4.7e-59
WP_064483023.1|3443630_3444536_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.7	3.2e-157
WP_015602232.1|3444528_3445083_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	8.7e-97
WP_015602442.1|3445093_3447457_+	phage Tail Collar domain protein	NA	Q45YG3	Burkholderia_virus	90.6	0.0e+00
WP_006027244.1|3447473_3448145_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	97.3	5.6e-106
WP_015600222.1|3448201_3449374_+|tail	phage tail sheath protein	tail	Q45YG5	Burkholderia_virus	98.5	1.3e-219
WP_015601762.1|3449389_3449899_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.2	9.2e-93
WP_015600156.1|3449956_3450301_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	98.2	9.7e-54
WP_009914998.1|3450309_3450426_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	86.8	8.3e-10
WP_015600980.1|3450428_3453389_+	hypothetical protein	NA	Q45YG8	Burkholderia_virus	95.3	0.0e+00
WP_015601642.1|3453406_3453832_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	98.6	9.7e-72
WP_015602174.1|3453831_3454932_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	96.2	1.8e-194
WP_006027238.1|3455004_3455223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909378.1|3455303_3455624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015601107.1|3455809_3456346_-	hypothetical protein	NA	A4JWX0	Burkholderia_virus	89.2	5.5e-88
>prophage 1
NZ_CP023498	Burkholderia thailandensis strain FDAARGOS_426 chromosome 2, complete sequence	2762025	734082	763211	2762025	plate,holin	Escherichia_phage(50.0%)	26	NA	NA
WP_167359318.1|734082_735291_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.6	7.9e-26
WP_006028807.1|735283_736186_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_015603856.1|736300_737299_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009915293.1|737418_738369_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_015603265.1|738443_738611_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_015603322.1|738661_739636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015603926.1|739828_740521_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	36.8	2.0e-21
WP_006028801.1|740988_741960_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015603788.1|741987_742764_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_009915291.1|742825_744148_-	MFS transporter	NA	NA	NA	NA	NA
WP_015603522.1|744249_744891_-	aldolase	NA	A0A077SK32	Escherichia_phage	45.1	3.3e-39
WP_015603703.1|744887_746231_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.6	8.1e-88
WP_015603177.1|746250_747141_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	57.3	1.9e-77
WP_015603993.1|747212_747917_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015602755.1|748107_748722_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006028793.1|748781_749249_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015602957.1|749362_749911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102812147.1|749932_753172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015602716.1|753206_755249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041862105.1|755245_757861_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015603224.1|757983_760518_-|plate	putative baseplate assembly protein	plate	A0A1Q1PVP2	Phage_DP-2017a	21.4	1.7e-09
WP_006028787.1|760514_760883_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_015602894.1|760893_761211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028785.1|761213_761726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015603911.1|761722_762847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028783.1|762860_763211_-|plate	baseplate wedge protein 53	plate	NA	NA	NA	NA
