The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	5753	16427	4588003	integrase	Enterobacteria_phage(60.0%)	13	2174:2190	10842:10858
2174:2190	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
WP_000152556.1|5753_6773_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	7.9e-43
WP_020839656.1|7243_8503_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	3.7e-74
WP_000970946.1|8556_9552_-	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
WP_010376679.1|9607_9844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000667328.1|9840_10404_+	type II restriction endonuclease PvuII	NA	A0A1B0UXL9	Roseobacter_phage	42.9	7.2e-30
WP_000210078.1|10623_11190_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
10842:10858	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
WP_000984211.1|11206_11452_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000198637.1|11448_12186_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	3.4e-80
WP_000556591.1|12723_12990_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_000980371.1|12986_13538_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
WP_001216601.1|13534_13762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743148.1|13758_14079_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783718.1|14093_16427_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
>prophage 2
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	668148	674179	4588003		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|668148_668295_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|668310_668454_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400612.1|669443_671366_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.5	1.9e-300
WP_000703599.1|671382_671637_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|671605_671995_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377775.1|673237_674179_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.5	2.7e-146
>prophage 3
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	903440	912611	4588003	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569167.1|903440_904388_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824856.1|904371_905103_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|905083_905191_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|905250_905982_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272855.1|906204_907890_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.9	3.7e-279
WP_000598637.1|907886_908606_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|908652_909120_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265354.1|909176_909707_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703141.1|909878_910337_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195335.1|910577_912611_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	991140	998796	4588003		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000697846.1|991140_992226_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023655.1|992225_993125_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000857533.1|993172_994051_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_000973711.1|994051_994603_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018223.1|994608_995583_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648782.1|995598_996372_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565907.1|996376_997456_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.7e-16
WP_000126347.1|997482_998796_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	1091345	1098572	4588003		Morganella_phage(33.33%)	7	NA	NA
WP_000394197.1|1091345_1091765_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457650.1|1091767_1093036_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000208509.1|1093481_1093694_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1093704_1093893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080667.1|1094153_1095332_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_000377044.1|1096372_1097068_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001157323.1|1097141_1098572_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	1800360	1808553	4588003		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|1800360_1800600_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_011233072.1|1801473_1802283_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_001277616.1|1802355_1802733_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|1802880_1803423_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_011233073.1|1803614_1804343_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_011233074.1|1804359_1804773_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_000915986.1|1805719_1806844_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444503.1|1807302_1808553_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 7
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	2058974	2068504	4588003	protease,integrase	Ralstonia_phage(16.67%)	8	2053764:2053778	2067240:2067254
2053764:2053778	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_011233091.1|2058974_2059352_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
WP_001117984.1|2059513_2059711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274276.1|2061111_2061642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2062140_2064417_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2064447_2064768_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2065091_2065313_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125879.1|2065442_2067389_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2067240:2067254	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|2067385_2068504_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 8
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	2620601	2665310	4588003	protease,terminase,integrase,lysis,coat,portal,holin	Salmonella_phage(51.52%)	67	2651391:2651404	2662686:2662699
WP_000915523.1|2620601_2620964_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703606.1|2620960_2621893_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.7	1.2e-175
WP_000671498.1|2621882_2623340_+	glucosyltransferase domain-containing protein	NA	E7C9N7	Salmonella_phage	99.2	1.4e-239
WP_000129927.1|2623398_2625402_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
WP_000532177.1|2625537_2625786_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|2625806_2626100_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000868979.1|2626238_2628170_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	99.1	0.0e+00
WP_000190212.1|2628169_2629540_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	99.3	1.6e-248
WP_000964851.1|2629549_2630239_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	2.9e-81
WP_000627703.1|2630241_2630697_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000774919.1|2630696_2631335_-	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_001122416.1|2631338_2632757_-	packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.8	2.4e-276
WP_001166094.1|2632716_2633217_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	98.8	1.2e-89
WP_000538674.1|2633200_2633761_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001196936.1|2633801_2635094_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_000433852.1|2635093_2636005_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774658.1|2636018_2638196_-|portal	portal protein p19	portal	I6R968	Salmonella_phage	98.6	0.0e+00
WP_000417866.1|2638195_2639695_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|2639672_2640161_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|2640164_2640569_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|2640571_2640814_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|2641137_2641659_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|2641871_2642321_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|2642338_2642776_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|2642759_2643086_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|2643520_2644144_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|2644140_2644329_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001046347.1|2644325_2644688_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	7.8e-62
WP_000002244.1|2644684_2644975_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|2644967_2645180_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|2645172_2645349_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_011233124.1|2645341_2645683_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	5.1e-63
WP_000113770.1|2645685_2645862_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679702.1|2645828_2646002_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000811302.1|2645998_2646445_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
WP_000049340.1|2646401_2646698_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_000344579.1|2646700_2647021_-	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	1.1e-22
WP_000975822.1|2647032_2647188_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000248682.1|2647199_2647406_-	hypothetical protein	NA	I6RSI5	Salmonella_phage	100.0	1.1e-31
WP_000131495.1|2647481_2648918_-	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	99.2	3.0e-274
WP_000065656.1|2648907_2649807_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	2.5e-154
WP_001125982.1|2649799_2649946_-	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_001103491.1|2649980_2650262_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.6e-43
WP_000182204.1|2650372_2650588_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|2650698_2651388_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
2651391:2651404	attL	AGCCAATGGCCTGA	NA	NA	NA	NA
WP_000680395.1|2651745_2651991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786965.1|2652029_2652239_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000216028.1|2652602_2652905_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	8.2e-49
WP_001066166.1|2652917_2653505_-	super-infection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	98.5	1.4e-84
WP_000213983.1|2653718_2653913_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000542409.1|2653949_2654243_+	hypothetical protein	NA	B8K1E3	Salmonella_phage	95.7	4.1e-45
WP_001200114.1|2654557_2654710_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	98.0	9.2e-25
WP_000156730.1|2654690_2654879_+	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_000902088.1|2654868_2655012_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	2.7e-18
WP_001046981.1|2655008_2655716_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_001111312.1|2656046_2656340_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|2656350_2656521_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_000665851.1|2656517_2657177_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	61.6	2.2e-62
WP_001017879.1|2657173_2657674_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	62.6	1.0e-64
WP_000582227.1|2657673_2658429_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	5.5e-150
WP_000208071.1|2658439_2659525_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	76.7	2.0e-153
WP_000002128.1|2659517_2659802_+	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_157804913.1|2659870_2660011_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	7.2e-16
WP_000051901.1|2660240_2661404_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	99.7	4.1e-229
WP_000893229.1|2661609_2662860_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.0e-97
2662686:2662699	attR	TCAGGCCATTGGCT	NA	NA	NA	NA
WP_001285277.1|2662871_2663975_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	9.0e-61
WP_001043666.1|2664257_2665310_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.3e-112
>prophage 9
NZ_CP023508	Salmonella enterica subsp. enterica serovar Paratyphi A strain FDAARGOS_368 chromosome, complete genome	4588003	2733744	2860594	4588003	tail,capsid,terminase,integrase,lysis,portal,plate,head,tRNA,holin	Salmonella_phage(51.85%)	128	2795884:2795932	2861694:2861742
WP_000108009.1|2733744_2734239_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371505.1|2734254_2736138_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|2736134_2737130_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367632.1|2737140_2738184_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|2738714_2739446_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|2739509_2739977_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801242.1|2739973_2740696_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052769.1|2740730_2741486_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_039755476.1|2741557_2742925_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	32.5	9.0e-10
WP_000207237.1|2742980_2743751_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|2743828_2744629_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127560.1|2744760_2745936_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648518.1|2746040_2746955_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154860.1|2746976_2747780_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_001235092.1|2753780_2756354_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|2756483_2757215_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2757211_2758192_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2758323_2759061_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2759332_2759671_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2759774_2759822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200087.1|2759921_2761082_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210975.1|2761042_2761951_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225183.1|2762008_2763130_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2763139_2764210_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|2764649_2765168_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|2765160_2766381_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|2766537_2766885_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|2766925_2767693_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2767737_2768286_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2768304_2768553_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460060.1|2768804_2770166_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2770331_2771123_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127908301.1|2771142_2772429_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000271804.1|2772558_2773164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2773204_2773795_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2773917_2774796_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2774881_2776543_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203433.1|2776691_2777030_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2777195_2777486_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|2777475_2777952_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2778100_2778583_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237661.1|2779201_2790676_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533854.1|2790740_2792150_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196157.1|2792146_2794327_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|2794334_2795498_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
2795884:2795932	attL	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_001039750.1|2796027_2796405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|2796491_2796710_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011749.1|2796777_2797878_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	3.0e-189
WP_000980405.1|2797874_2798360_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|2798359_2800906_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|2801132_2801252_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|2801266_2801569_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|2801623_2802139_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|2802148_2803321_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|2803423_2803642_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161709.1|2803855_2804578_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|2804775_2805183_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_001274654.1|2805189_2806809_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	91.2	3.2e-155
WP_001086800.1|2806805_2807411_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	1.3e-117
WP_000268328.1|2807403_2808312_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.7	3.5e-159
WP_000177408.1|2808298_2808658_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993747.1|2808654_2809233_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_000343944.1|2809301_2809748_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039961.1|2809740_2810172_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024131238.1|2810267_2810696_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|2810692_2811070_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001069889.1|2811074_2811584_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.2e-92
WP_000171565.1|2811564_2811780_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2811783_2811987_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|2811986_2812451_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|2812544_2813195_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|2813198_2814263_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|2814279_2815113_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098454.1|2815255_2817022_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
WP_011233140.1|2817021_2818065_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.0	1.2e-174
WP_000080839.1|2818113_2818809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789324.1|2818828_2819893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039755430.1|2819889_2820954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|2820963_2821182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|2821277_2821511_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|2821522_2821711_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_000301196.1|2821878_2824281_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.5	0.0e+00
WP_000104130.1|2824271_2825132_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|2825128_2825713_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|2825709_2825937_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|2825936_2826170_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|2826237_2826579_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|2826542_2826743_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|2826750_2827260_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|2827292_2827535_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|2827651_2828284_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|2828287_2829313_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001177838.1|2829556_2829805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|2831429_2832548_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000977532.1|2833227_2834931_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000200793.1|2834930_2835476_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_000267952.1|2835447_2836173_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000421117.1|2836162_2836690_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000084304.1|2836707_2838735_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_001001826.1|2838744_2839332_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000136924.1|2839324_2840509_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001002797.1|2840505_2840835_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811085.1|2840831_2842802_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_000411339.1|2842989_2843247_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376372.1|2843393_2843726_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000175560.1|2843725_2844067_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|2844063_2844357_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166742.1|2844366_2844822_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_000220202.1|2844818_2845946_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000560074.1|2845942_2846650_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000084220.1|2846646_2847153_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001680743.1|2847149_2847602_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218536.1|2847698_2848400_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_000550496.1|2848403_2849426_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|2849487_2850288_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151947.1|2850448_2852224_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038210.1|2852220_2853282_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|2853278_2853602_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960960.1|2853575_2853794_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001137729.1|2853906_2855658_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_016504913.1|2855784_2855928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233149.1|2855968_2856781_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.3	8.8e-122
WP_000057334.1|2856771_2857002_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|2857069_2857471_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000643374.1|2857885_2858113_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_023211710.1|2858122_2858626_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000687097.1|2859008_2859581_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_012532529.1|2859580_2860594_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
2861694:2861742	attR	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
