The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021040	Phaeobacter gallaeciensis strain P129 chromosome, complete genome	3707098	423811	513877	3707098	tail,integrase,terminase,portal,capsid,holin,plate,protease,tRNA	Escherichia_phage(34.29%)	95	450965:451021	488143:488199
WP_096705746.1|423811_424153_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	39.4	4.5e-11
WP_096705747.1|424167_425160_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096705748.1|425266_426070_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096705749.1|426107_427001_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_096705750.1|427125_427953_+	glycoside hydrolase family 25 protein	NA	A0A1U9WQS3	Geobacillus_phage	38.9	1.9e-26
WP_096705751.1|428030_428993_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_096705752.1|429103_430138_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_173674605.1|430237_430405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705753.1|430407_431508_-	CoA transferase	NA	NA	NA	NA	NA
WP_096705754.1|431723_433904_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.8	8.4e-127
WP_024095935.1|433933_434128_-	SlyX family protein	NA	NA	NA	NA	NA
WP_096705755.1|434333_435821_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	27.2	8.5e-30
WP_024095937.1|435824_436913_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_096705756.1|436909_437602_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_096705757.1|437867_438530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024095943.1|440402_440918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705759.1|441563_443150_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_096705760.1|443282_444497_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_096705761.1|444496_446569_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_148665589.1|446569_449278_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	33.2	2.1e-127
WP_158524526.1|449674_449977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096705763.1|450075_450864_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	26.3	3.6e-11
450965:451021	attL	TTTTATTGGTCGGAGCGAGAGGATTCGAACCTCCGGCCCCTGCCTCCCGAAGACAGT	NA	NA	NA	NA
WP_096705764.1|451119_452199_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A240F4W2	Ochrobactrum_phage	34.3	5.2e-53
WP_096705765.1|452382_452673_-	hypothetical protein	NA	A0A0A8IK95	Aurantimonas_phage	71.0	1.5e-31
WP_096705766.1|452703_452889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158524527.1|453140_454742_-	DNA cytosine methyltransferase	NA	Q71TA0	Escherichia_phage	41.1	3.3e-88
WP_158524528.1|454777_454969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705768.1|455174_455504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705769.1|455503_455755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148665590.1|455751_456063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705770.1|456187_456775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705771.1|456834_457491_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_096705772.1|457655_457970_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082760618.1|458088_458301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096705773.1|458402_458924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705774.1|458920_459157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705775.1|460046_460958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096705776.1|460957_461272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173674635.1|461651_461924_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	87.8	2.7e-35
WP_096705778.1|461932_462358_+	hypothetical protein	NA	A0A1X9HXA5	Ruegeria_phage	70.2	9.2e-46
WP_096705779.1|462354_462774_+	DUF1064 domain-containing protein	NA	A0A1X9HVJ6	Ruegeria_phage	39.8	1.2e-16
WP_096705780.1|462783_463350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705781.1|463739_464642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705783.1|465416_466607_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_027247879.1|466851_467088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096707826.1|467285_467858_+	lysozyme	NA	A0A0K1LL70	Rhodobacter_phage	44.1	1.6e-29
WP_096705784.1|467857_468241_+	bacteriophage spanin2 family protein	NA	NA	NA	NA	NA
WP_096705785.1|468412_468964_+|terminase	terminase small subunit	terminase	A0A1W6JT64	Escherichia_phage	49.7	5.6e-35
WP_096705786.1|468960_470910_+|terminase	phage terminase large subunit family protein	terminase	A0A088FQV3	Escherichia_phage	62.3	1.6e-225
WP_096705787.1|470919_471450_+	hypothetical protein	NA	A0A1W6JT65	Escherichia_phage	44.5	4.5e-34
WP_096707827.1|471515_473042_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	50.8	5.5e-133
WP_096705788.1|473034_475065_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	49.6	5.7e-170
WP_096705789.1|475139_475370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705790.1|475369_475681_+	hypothetical protein	NA	A0A193GYM3	Enterobacter_phage	44.8	8.3e-20
WP_096705791.1|475640_476234_+|tail	phage tail protein	tail	A0A193GYC6	Enterobacter_phage	46.4	4.9e-37
WP_096705792.1|476237_476771_+	hypothetical protein	NA	D5LGZ6	Escherichia_phage	43.6	6.6e-33
WP_096705793.1|476767_477193_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_027247867.1|477192_477483_+	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	58.6	6.7e-24
WP_096705794.1|477532_477871_+	GPW/gp25 family protein	NA	A0A088FV58	Escherichia_phage	65.8	1.7e-34
WP_096705795.1|477870_478770_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	51.0	8.7e-78
WP_096707828.1|478762_479482_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	48.3	3.4e-32
WP_096705796.1|479478_480036_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	34.2	6.1e-05
WP_096705797.1|480040_480367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705798.1|480363_481233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705799.1|481244_481727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705800.1|481826_483044_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A088FVH5	Escherichia_phage	54.5	6.1e-135
WP_014880200.1|483043_483550_+|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	53.6	2.9e-46
WP_052463898.1|483559_483853_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	51.6	8.9e-08
WP_096705801.1|483967_486463_+|tail	phage tail tape measure protein	tail	A0A0U2BXT9	Paracoccus_phage	29.7	1.3e-17
WP_096707829.1|486462_486873_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	54.5	7.3e-32
WP_096705802.1|486841_487063_+|tail	tail protein X	tail	A0A1W6JT40	Escherichia_phage	54.5	4.8e-14
WP_096705803.1|487053_488061_+	late control protein D	NA	A0A088FRU7	Escherichia_phage	43.2	3.9e-71
WP_096705804.1|488268_489225_-	DMT family transporter	NA	NA	NA	NA	NA
488143:488199	attR	TTTTATTGGTCGGAGCGAGAGGATTCGAACCTCCGGCCCCTGCCTCCCGAAGACAGT	NA	NA	NA	NA
WP_096705805.1|489435_490539_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_096705806.1|490680_491745_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_096705807.1|491741_492575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705808.1|492934_493912_+	DUF2332 domain-containing protein	NA	NA	NA	NA	NA
WP_096705809.1|493981_494587_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_096705810.1|494599_496003_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_096705811.1|496307_497669_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_024095960.1|497898_498267_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_040174860.1|498352_498823_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_096705812.1|498862_499231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705813.1|499267_500026_-	DUF599 domain-containing protein	NA	NA	NA	NA	NA
WP_096705814.1|500116_501565_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_096705815.1|501649_502750_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_096705816.1|502753_504088_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_096705817.1|504218_505073_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_096705818.1|505069_505885_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014875848.1|506018_506477_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	47.0	7.9e-27
WP_096705819.1|506577_508767_-	esterase-like activity of phytase family protein	NA	E3SJA5	Synechococcus_phage	48.1	6.1e-93
WP_096705820.1|508898_510374_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096705821.1|510573_511359_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096705822.1|511579_512788_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_024095973.1|513124_513877_+|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
>prophage 3
NZ_CP021040	Phaeobacter gallaeciensis strain P129 chromosome, complete genome	3707098	1500437	1568003	3707098	tail,capsid,portal,protease,tRNA,head	uncultured_Mediterranean_phage(22.22%)	64	NA	NA
WP_096706461.1|1500437_1501730_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.5	6.2e-85
WP_096706462.1|1501847_1503404_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096706463.1|1503579_1503864_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	53.8	2.0e-20
WP_096706464.1|1503898_1505560_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.0	1.6e-05
WP_024096949.1|1505562_1506531_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.7	4.7e-61
WP_024096950.1|1506697_1507051_+	membrane protein	NA	NA	NA	NA	NA
WP_096706465.1|1507148_1507775_+	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	29.2	7.8e-09
WP_096706466.1|1507771_1508428_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_014874910.1|1508473_1509205_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_040104006.1|1509204_1509375_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_096706467.1|1509367_1509907_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_096706468.1|1509981_1510281_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_096706469.1|1510556_1513244_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_096706470.1|1513489_1514221_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_096707896.1|1514235_1515171_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_096706471.1|1515541_1516741_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_096706472.1|1516817_1517423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040178692.1|1517612_1518917_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.2	6.6e-18
WP_096706473.1|1519196_1520453_-	OsmC family protein	NA	NA	NA	NA	NA
WP_096706474.1|1520548_1521109_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096707897.1|1521185_1522529_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024096966.1|1522716_1523475_+	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_024096967.1|1523512_1524538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096968.1|1525079_1526486_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014874894.1|1526579_1526918_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_096706475.1|1527110_1528805_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_096706476.1|1529179_1531384_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	1.4e-12
WP_024096971.1|1531793_1532924_+	porin	NA	NA	NA	NA	NA
WP_096707898.1|1533181_1534513_+	trigger factor	NA	NA	NA	NA	NA
WP_096706477.1|1534709_1535978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096706478.1|1536276_1538235_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_096706479.1|1538385_1538856_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024096976.1|1539168_1539351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096706480.1|1539583_1540198_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005982441.1|1540210_1540438_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014874885.1|1540466_1540820_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_096706481.1|1541345_1541942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874883.1|1542177_1542753_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_096706482.1|1542952_1544101_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	34.9	1.3e-57
WP_096706483.1|1544290_1545592_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_096706484.1|1545777_1546710_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024096983.1|1546794_1547532_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005982462.1|1548166_1548400_+	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_096706485.1|1548564_1549308_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_096706486.1|1549498_1550512_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_096706487.1|1550771_1552037_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_096706488.1|1552036_1553191_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_096706489.1|1553482_1553818_+	recombinase	NA	NA	NA	NA	NA
WP_096706490.1|1553834_1555088_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.7	2.2e-71
WP_096706491.1|1555291_1556485_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	3.1e-59
WP_040169410.1|1556477_1556696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096706492.1|1556731_1557349_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	56.2	1.8e-34
WP_096706493.1|1557397_1558582_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	2.6e-61
WP_173674613.1|1558768_1559416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096706494.1|1559412_1559784_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_096706495.1|1559780_1560194_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_096706496.1|1560300_1560714_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_096706497.1|1560728_1561082_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_096706498.1|1561078_1561336_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_096706499.1|1561328_1561985_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	35.6	1.7e-14
WP_096706500.1|1562000_1562633_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	4.5e-57
WP_096706501.1|1562632_1563583_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.8	3.9e-52
WP_024097003.1|1563579_1564050_+	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.3e-29
WP_096706502.1|1564049_1568003_+|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	37.6	6.4e-226
