The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	1602002	1605289	3775737		Pseudomonas_phage(16.67%)	7	NA	NA
WP_024097693.1|1602002_1602584_-	hypothetical protein	NA	K4NZ13	Pseudomonas_phage	55.2	2.7e-16
WP_040104145.1|1602605_1602911_-	DUF1364 domain-containing protein	NA	A0A088F868	Sulfitobacter_phage	60.4	7.3e-29
WP_024097691.1|1602979_1603435_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	29.2	2.0e-06
WP_024097690.1|1603448_1603739_-	hypothetical protein	NA	A0A0B5HDX4	Vibrio_phage	59.8	6.5e-27
WP_024097689.1|1603738_1603927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097688.1|1603926_1604631_-	3'-5' exonuclease	NA	X2CYL5	Brucella_phage	45.3	2.3e-41
WP_024097687.1|1604620_1605289_-	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	48.9	9.1e-24
>prophage 2
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	1609028	1619876	3775737	terminase,coat	Vibrio_phage(33.33%)	14	NA	NA
WP_024097675.1|1609028_1609337_+	VRR-NUC domain protein	NA	E2GLY0	Acinetobacter_phage	55.7	1.6e-20
WP_024097674.1|1609333_1609867_+	T5domain protein	NA	A0A088F856	Sulfitobacter_phage	52.3	2.6e-45
WP_043939784.1|1609950_1610661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097672.1|1610647_1611016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097671.1|1611012_1611381_+	ATPase involved in DNA replication initiation	NA	NA	NA	NA	NA
WP_024097670.1|1611380_1611851_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	81.7	4.4e-49
WP_024097669.1|1611919_1612273_+	HNH endonuclease	NA	A0A0B4N249	Escherichia_phage	49.0	5.5e-20
WP_040104067.1|1612284_1612671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097666.1|1612939_1613530_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_024097665.1|1614157_1614460_+	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	41.6	1.5e-05
WP_024097664.1|1614440_1615778_+|terminase	phage terminase large subunit	terminase	F8TUR5	EBPR_podovirus	71.8	6.2e-181
WP_024097663.1|1615774_1617766_+	hypothetical protein	NA	I3PUX6	Vibrio_phage	39.6	3.6e-124
WP_024097662.1|1617779_1618622_+	hypothetical protein	NA	I3PUX5	Vibrio_phage	31.1	3.7e-14
WP_024097661.1|1618634_1619876_+|coat	phage coat protein	coat	I3PUX4	Vibrio_phage	34.3	5.4e-54
>prophage 3
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	2098777	2113728	3775737	portal,tail,head,capsid,terminase,protease	Brucella_phage(27.27%)	23	NA	NA
WP_024097213.1|2098777_2099224_-	hypothetical protein	NA	A0A2I7RB20	Vibrio_phage	32.0	5.9e-11
WP_024097212.1|2099284_2099572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097211.1|2099616_2099970_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024097210.1|2099969_2100425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097209.1|2100421_2100748_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024097208.1|2100747_2101317_-	hypothetical protein	NA	A0A141GEW4	Brucella_phage	43.1	3.1e-33
WP_024097207.1|2101323_2101464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097206.1|2101524_2102763_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	55.6	2.1e-127
WP_024097205.1|2102779_2103616_-|protease	Clp protease ClpP	protease	A0A141GEW1	Brucella_phage	73.9	8.5e-112
WP_024097204.1|2103593_2104844_-|portal	phage portal protein	portal	A0A141GEV9	Brucella_phage	52.9	3.4e-104
WP_024097203.1|2104851_2106630_-|terminase	phage terminase-like protein, large subunit	terminase	B0VK29	Azospirillum_phage	40.5	6.9e-119
WP_024097202.1|2106607_2107015_-|terminase	phage terminase small subunit	terminase	NA	NA	NA	NA
WP_145957933.1|2107190_2107517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097200.1|2107513_2107705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081731415.1|2107707_2107932_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_024097199.1|2108126_2108705_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_024097198.1|2108694_2110383_-	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	47.6	6.3e-138
WP_024097197.1|2110382_2110763_-	hypothetical protein	NA	A0A1X9HVL1	Ruegeria_phage	35.1	1.5e-07
WP_024097196.1|2110831_2111248_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	42.9	2.6e-08
WP_024097195.1|2111257_2111920_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	60.5	4.4e-55
WP_024097194.1|2111912_2112227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097193.1|2112226_2113138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024097192.1|2113134_2113728_-	SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	48.3	1.3e-42
>prophage 4
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	2118778	2126741	3775737	integrase	Rhizobium_phage(16.67%)	10	2124198:2124210	2127638:2127650
WP_024097181.1|2118778_2119552_+	hypothetical protein	NA	A0A068CE44	Rhizobium_phage	28.8	3.6e-08
WP_052331592.1|2119582_2120329_+	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	52.9	1.1e-57
WP_024097179.1|2120353_2120743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052440150.1|2120799_2122887_+	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	59.7	4.6e-215
WP_024097179.1|2122916_2123306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097178.1|2123362_2123509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096596809.1|2123582_2124281_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	45.0	2.0e-29
2124198:2124210	attL	AGCTGGGCGTCAA	NA	NA	NA	NA
WP_024097175.1|2124516_2124693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097174.1|2124714_2125368_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	45.5	6.4e-30
WP_024097172.1|2125661_2126741_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A240F4W2	Ochrobactrum_phage	33.2	1.4e-50
2127638:2127650	attR	TTGACGCCCAGCT	NA	NA	NA	NA
>prophage 5
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	2266496	2338084	3775737	tRNA,tail,head,capsid,integrase	uncultured_Mediterranean_phage(26.67%)	62	2258678:2258695	2308321:2308338
2258678:2258695	attL	CGCCAGCGAGGCCTGCGC	NA	NA	NA	NA
WP_024097056.1|2266496_2267129_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024097055.1|2267410_2268481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097053.1|2270072_2271074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097052.1|2271066_2271723_-	adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
WP_024097051.1|2271722_2272478_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.6	5.9e-11
WP_024097050.1|2272474_2273458_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_081731412.1|2273454_2274258_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081731411.1|2274294_2276247_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	37.2	2.6e-10
WP_024097047.1|2277176_2277962_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_024097046.1|2277972_2278590_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_024097045.1|2278586_2279174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097044.1|2279170_2279959_+	cobalt ECF transporter T component CbiQ	NA	NA	NA	NA	NA
WP_024097043.1|2279945_2280596_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.3e-14
WP_024097042.1|2281006_2281309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097041.1|2281481_2282453_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_024097040.1|2282733_2283735_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_024097038.1|2284051_2284546_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.5	1.4e-32
WP_024097037.1|2284688_2285123_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024097036.1|2285179_2286076_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024097035.1|2286208_2287708_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024097034.1|2287921_2288950_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_024097033.1|2289135_2289735_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024097032.1|2289984_2291742_-	O-linked N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_024097031.1|2292048_2293194_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024097030.1|2293201_2294248_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024097029.1|2294244_2295120_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_024097028.1|2295911_2298788_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	60.8	0.0e+00
WP_040104010.1|2298898_2300149_-	MFS transporter	NA	NA	NA	NA	NA
WP_024097026.1|2300277_2301672_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_024097025.1|2301862_2302441_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	28.7	4.6e-16
WP_024097024.1|2302578_2303853_-	MFS transporter	NA	NA	NA	NA	NA
WP_024097023.1|2304099_2305170_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_024097022.1|2305251_2308971_-	outer membrane biogenesis protein	NA	NA	NA	NA	NA
2308321:2308338	attR	CGCCAGCGAGGCCTGCGC	NA	NA	NA	NA
WP_024097021.1|2309071_2309533_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_024097020.1|2309660_2310542_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024097019.1|2310948_2312280_+	peptidoglycan DD-metalloendopeptidase family protein	NA	S5M424	Bacillus_phage	44.3	1.1e-17
WP_024097018.1|2312269_2312812_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_024097017.1|2313070_2314315_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_024097016.1|2314566_2316063_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_024097015.1|2316145_2317129_-	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_024097014.1|2317312_2317861_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.5	7.4e-40
WP_024097013.1|2317853_2318360_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	54.4	2.1e-41
WP_024097012.1|2318541_2319732_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_040104009.1|2319987_2320287_+	septum formation initiator precursor	NA	NA	NA	NA	NA
WP_024097010.1|2320577_2321591_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_024097009.1|2321607_2322987_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
WP_024097008.1|2322999_2324322_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_145957934.1|2324643_2325708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097006.1|2326096_2326915_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_024097005.1|2327144_2327468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097004.1|2327480_2331434_-|tail	phage tail protein	tail	A0A0B5A7K5	Paracoccus_phage	37.5	6.4e-226
WP_024097003.1|2331433_2331904_-	phage cell wall peptidase NlpC/P60 family	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.3e-29
WP_024097002.1|2331900_2332851_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.8	2.5e-51
WP_024097001.1|2332850_2333483_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	2.0e-57
WP_024097000.1|2333498_2334155_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	36.6	1.7e-14
WP_024096999.1|2334147_2334405_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024096998.1|2334401_2334755_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_024096997.1|2334769_2335183_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_024096996.1|2335287_2335701_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024096995.1|2335697_2336069_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_043939826.1|2336065_2336710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096993.1|2336899_2338084_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	3.3e-61
>prophage 6
NZ_CP010636	Phaeobacter gallaeciensis strain P73 chromosome, complete genome	3775737	2699395	2759465	3775737	tRNA,transposase,lysis,integrase	Bacillus_virus(14.29%)	58	2730278:2730292	2736045:2736059
WP_024096666.1|2699395_2700883_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_008561736.1|2700886_2701174_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024096665.1|2701369_2702062_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_024096664.1|2702198_2702822_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024096663.1|2702882_2703344_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_040103962.1|2703406_2704669_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_024096661.1|2704859_2705777_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_024096660.1|2705799_2706996_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_040103961.1|2707082_2707967_+	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_024096658.1|2708065_2709253_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_024096656.1|2709557_2710709_+	TFIIB-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_024096655.1|2710764_2711436_+	nitroreductase	NA	NA	NA	NA	NA
WP_024096654.1|2711464_2711911_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_024096652.1|2712367_2713954_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096651.1|2713968_2714925_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096650.1|2714921_2715737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096649.1|2715733_2717371_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.2e-22
WP_024096648.1|2717496_2718333_+	protein of the AP superfamily	NA	NA	NA	NA	NA
WP_024096647.1|2718389_2718953_+	DUF4453 domain-containing protein	NA	NA	NA	NA	NA
WP_024096646.1|2718955_2719882_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024096645.1|2720021_2721917_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	2.6e-23
WP_024096644.1|2722098_2723898_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	6.0e-62
WP_024096643.1|2724292_2724841_-	carbon monoxide dehydrogenase subunit G	NA	NA	NA	NA	NA
WP_024096642.1|2725211_2725928_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_040103947.1|2725945_2727199_+	GfdT protein	NA	NA	NA	NA	NA
WP_024096640.1|2727195_2729466_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	28.9	9.1e-15
WP_024096639.1|2729641_2730391_+	hypothetical protein	NA	NA	NA	NA	NA
2730278:2730292	attL	GCAGGCTTTGGCGGC	NA	NA	NA	NA
WP_024096638.1|2730790_2731822_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	23.6	2.0e-06
WP_024096637.1|2731818_2732010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096636.1|2732034_2732229_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_040103946.1|2732313_2732628_+	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	56.1	3.1e-06
WP_024096634.1|2732630_2733272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040103945.1|2733430_2733643_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024096633.1|2733784_2734504_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	6.4e-31
WP_024096632.1|2734500_2734797_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024096631.1|2735203_2735902_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_024096630.1|2735902_2736445_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2736045:2736059	attR	GCCGCCAAAGCCTGC	NA	NA	NA	NA
WP_024096629.1|2736549_2737299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096628.1|2737356_2737881_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_024096627.1|2738113_2739574_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.7	2.5e-106
WP_024096626.1|2739671_2740616_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	28.1	7.6e-08
WP_024096625.1|2741172_2742843_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024096624.1|2742916_2744002_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096623.1|2744014_2745220_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024096622.1|2745314_2747405_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	2.1e-10
WP_024096621.1|2747461_2748265_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024096620.1|2748269_2749274_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096619.1|2749392_2750142_-	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	2.2e-10
WP_024096618.1|2750154_2751042_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096617.1|2751031_2751787_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024096616.1|2751815_2752649_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024096615.1|2752818_2753562_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040103941.1|2753564_2756255_+	response regulator	NA	A0A1V0SGX0	Hokovirus	37.4	1.8e-33
WP_024096613.1|2756242_2757052_-	response regulator	NA	Q6JIH3	Burkholderia_virus	52.3	4.2e-07
WP_024096612.1|2757785_2758562_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	3.0e-42
WP_096596796.1|2758574_2758685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096611.1|2758694_2759276_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_040103929.1|2759333_2759465_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP010638	Phaeobacter gallaeciensis strain P73 plasmid pP73_b, complete sequence	171534	111138	160097	171534	transposase,integrase	Vibrio_phage(33.33%)	47	112774:112833	154177:154322
WP_024099411.1|111138_112773_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
112774:112833	attL	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGAT	NA	NA	NA	NA
WP_007803148.1|112902_113565_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052440151.1|113842_114832_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705159.1|114910_115219_-	universal stress protein	NA	NA	NA	NA	NA
WP_082032859.1|115808_116069_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_040104548.1|116232_116538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158524501.1|116677_117619_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096705141.1|117681_118392_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_082032860.1|118485_119037_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040104532.1|120425_121664_-	amidohydrolase	NA	NA	NA	NA	NA
WP_040104531.1|121684_121984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104533.1|121970_122312_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_040104530.1|122558_122903_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705142.1|122899_123838_-	EamA family transporter	NA	NA	NA	NA	NA
WP_096705143.1|123865_124309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104538.1|124322_125195_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096705144.1|125311_126448_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096705145.1|126488_127427_-	oxidoreductase	NA	NA	NA	NA	NA
WP_096705146.1|127567_128713_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_040104545.1|128840_130121_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_096705147.1|130432_131008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705148.1|131208_133059_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_096705149.1|133279_134269_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_040104543.1|134580_135048_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705150.1|135529_136564_-	dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	31.2	1.5e-20
WP_096705151.1|136563_138333_-	acetolactate synthase	NA	G8DDL3	Micromonas_pusilla_virus	24.4	8.6e-05
WP_096705152.1|138466_139318_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_007803185.1|139444_140923_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_040545992.1|140979_141735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040104559.1|141843_142563_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_008335453.1|142580_143258_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_076626053.1|143254_144454_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_158524502.1|144459_145377_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705153.1|145452_146235_+	3-oxoadipate enol-lactonase	NA	A0A023W7H4	Mycobacterium_phage	34.6	1.2e-06
WP_065818607.1|146231_146612_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_096705154.1|146611_147340_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_096705155.1|147341_147947_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_096705156.1|148018_149083_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_096705157.1|149214_149940_-	HAD family hydrolase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	29.7	2.8e-10
WP_096705158.1|150056_150878_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.7	3.6e-46
WP_007803196.1|150870_151662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099410.1|151658_152540_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024099411.1|152541_154176_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_007803209.1|155082_156477_+	membrane protein	NA	NA	NA	NA	NA
154177:154322	attR	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGATTTAAAGGCAAAATATCATATTTAAGGGCAAAGCAAGGCCGTTGATTTCGTTGGATTTCTCATCTCACAATTAAGGGCTACGCGACA	NA	NA	NA	NA
WP_007803213.1|157407_158199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007803215.1|158195_159074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_007803217.1|159164_160097_-|transposase	IS5-like element ISRhba5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	37.5	2.5e-51
