The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010673	Phaeobacter gallaeciensis strain P75 chromosome, complete genome	3811156	1091124	1180666	3811156	head,terminase,tail,transposase,plate	Rhodovulum_phage(18.92%)	115	NA	NA
WP_024096545.1|1091124_1092513_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_024096546.1|1092704_1094207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040103924.1|1094208_1094658_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_024096548.1|1094661_1095612_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_024096549.1|1095636_1096368_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096550.1|1096448_1097228_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_158524442.1|1097331_1098228_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096552.1|1098404_1099307_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_040103925.1|1099320_1099911_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096554.1|1100003_1100549_+	redoxin family protein	NA	NA	NA	NA	NA
WP_024096555.1|1100545_1100950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096556.1|1100973_1101429_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_024096557.1|1101442_1101877_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_024096558.1|1101918_1102305_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024096559.1|1102350_1103505_-	amidohydrolase	NA	NA	NA	NA	NA
WP_024096560.1|1103574_1104384_-	agmatinase	NA	NA	NA	NA	NA
WP_040103927.1|1104398_1105439_-	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	47.3	6.3e-88
WP_024096562.1|1105450_1106374_-	DMT family transporter	NA	NA	NA	NA	NA
WP_096705073.1|1106370_1107792_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_158524499.1|1107981_1108854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096565.1|1109056_1110424_+	YjiH family protein	NA	NA	NA	NA	NA
WP_024096566.1|1110506_1110914_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_024096567.1|1111386_1112385_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_024096568.1|1112406_1112583_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_096705074.1|1113792_1114233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705075.1|1114282_1115080_-	hypothetical protein	NA	A0A1B0T6H5	Thiobacimonas_phage	45.5	2.4e-47
WP_096705076.1|1115418_1115868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705077.1|1115867_1116110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705078.1|1116099_1116969_+	ParB N-terminal domain-containing protein	NA	A0A1B0T6M1	Pelagibaca_phage	38.4	1.0e-35
WP_096705079.1|1116968_1119119_+|transposase	transposase	transposase	A0A1B1P6Z4	Rhodovulum_phage	57.2	7.8e-242
WP_096705080.1|1119195_1119939_+	ATP-binding protein	NA	A0A1B1P6Z7	Rhodovulum_phage	66.3	2.2e-87
WP_096705081.1|1119935_1120163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705082.1|1120159_1120747_+	hypothetical protein	NA	A0A1B1P6Z8	Rhodovulum_phage	60.4	3.2e-57
WP_096705083.1|1120743_1121115_+	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	59.2	1.8e-37
WP_096705084.1|1121111_1121762_+	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	62.1	5.0e-75
WP_096705085.1|1121920_1122424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705086.1|1122420_1122873_+	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	54.4	8.3e-37
WP_096705087.1|1122869_1123118_+	hypothetical protein	NA	A0A1B1P700	Rhodovulum_phage	47.5	5.2e-09
WP_096705088.1|1123114_1123501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705089.1|1123589_1124009_+	lysozyme	NA	A0A1B1P706	Rhodovulum_phage	53.1	1.5e-37
WP_096705090.1|1124005_1124536_+	hypothetical protein	NA	A0A2I7R2S9	Vibrio_phage	31.7	9.5e-16
WP_096705091.1|1124523_1124880_+	DUF2730 family protein	NA	A0A1B1P705	Rhodovulum_phage	60.6	6.3e-24
WP_096705092.1|1124876_1125176_+	hypothetical protein	NA	A0A1B0T6F4	Thiobacimonas_phage	52.6	1.5e-23
WP_096705093.1|1125177_1125642_+	DUF3310 domain-containing protein	NA	A0A088FRG2	Mycobacterium_phage	70.6	5.9e-22
WP_096705094.1|1125619_1126156_+	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	56.2	5.9e-50
WP_096705095.1|1126481_1126691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705096.1|1126687_1128082_+|terminase	terminase	terminase	A0A1B1P714	Rhodovulum_phage	76.1	1.2e-198
WP_096705097.1|1128081_1129626_+	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	47.4	2.8e-132
WP_096705098.1|1129618_1130827_+|head	head morphogenesis protein	head	A0A219VH74	Ochrobactrum_phage	41.8	4.1e-75
WP_096705099.1|1131172_1132162_+	hypothetical protein	NA	A0A2P9JZJ0	Alteromonadaceae_phage	47.0	2.1e-72
WP_096705100.1|1132167_1133079_+|head	head protein	head	L7P7Y9	Pseudomonas_phage	52.6	2.4e-83
WP_096705101.1|1133090_1133471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158524547.1|1133650_1134109_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_096705103.1|1134111_1134558_+	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	34.4	4.5e-11
WP_096705104.1|1134554_1135100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705105.1|1135099_1135525_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	33.1	7.3e-11
WP_096705106.1|1135524_1135875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705107.1|1135871_1136213_+|plate	phage baseplate protein	plate	R9TRM1	Vibrio_phage	44.1	6.5e-18
WP_096705108.1|1136209_1137118_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	49.0	3.3e-69
WP_096705109.1|1137110_1137806_+|tail	phage tail protein I	tail	A4PE44	Ralstonia_virus	38.7	2.3e-22
WP_096705110.1|1137806_1138367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705111.1|1138363_1140037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705112.1|1140051_1140543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096705113.1|1140535_1141720_+|tail	phage tail protein	tail	A0A1W6JT53	Escherichia_phage	43.3	1.3e-92
WP_096705114.1|1141730_1142228_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	42.0	2.8e-30
WP_096705135.1|1142369_1142690_+|tail	phage tail assembly protein	tail	E5FFG6	Burkholderia_phage	45.7	4.2e-11
WP_096705115.1|1142716_1142863_+|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	71.4	4.9e-07
WP_096705116.1|1142879_1145762_+|tail	phage tail tape measure protein	tail	A0A088FV68	Escherichia_phage	32.8	1.3e-47
WP_096705117.1|1145758_1146193_+|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	46.3	4.0e-28
WP_096705118.1|1146189_1146393_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	54.2	2.3e-10
WP_145958737.1|1146396_1147377_+|tail	phage tail protein	tail	D4HTW7	Vibrio_phage	40.8	1.4e-49
WP_096705119.1|1147373_1147748_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_096705120.1|1147883_1148714_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	58.6	8.0e-86
WP_024096570.1|1148991_1150305_-	type IV secretion pathway protein VirB10	NA	NA	NA	NA	NA
WP_024096571.1|1150297_1150993_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_024096572.1|1150996_1151647_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_024096573.1|1151651_1152431_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_024096574.1|1152427_1153576_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	56.4	7.5e-26
WP_024096575.1|1153568_1153727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096576.1|1153719_1156086_-	type IV secretion pathway protein VirB4	NA	NA	NA	NA	NA
WP_024096577.1|1156075_1156354_-	type IV secretion pathway protein VirB3	NA	NA	NA	NA	NA
WP_024096578.1|1156361_1156652_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_024096579.1|1156651_1157230_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.3	9.0e-20
WP_024096580.1|1157294_1157621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096582.1|1158456_1158936_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705122.1|1159037_1160219_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_155808116.1|1160796_1160937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096585.1|1161016_1161466_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096586.1|1161589_1162543_+	catalase	NA	NA	NA	NA	NA
WP_024096587.1|1162737_1163175_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052331584.1|1163271_1164225_+	catalase	NA	NA	NA	NA	NA
WP_024096589.1|1164359_1164779_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_024096590.1|1164857_1165595_+	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_024096591.1|1165595_1165886_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_024096592.1|1165875_1167495_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_024096593.1|1167500_1168232_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_024096594.1|1168228_1168396_+	cbb3-type cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_024096595.1|1168386_1169259_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_024096596.1|1169245_1169410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096597.1|1169455_1169911_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_024096598.1|1170018_1170528_+	Heme/copper-type cytochrome/quinol oxidase subunit 2	NA	NA	NA	NA	NA
WP_024096599.1|1170528_1171989_+	Heme/copper-type cytochrome/quinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_024096600.1|1171988_1172588_+	SCO family protein	NA	NA	NA	NA	NA
WP_043939779.1|1172590_1173145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096602.1|1173151_1173982_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_145957939.1|1173978_1174530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040103928.1|1174553_1174892_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_024096605.1|1175264_1175411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052331586.1|1175564_1175849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331587.1|1175905_1177345_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024096607.1|1177481_1178258_+	aldolase	NA	NA	NA	NA	NA
WP_024096608.1|1178268_1179156_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_096753138.1|1179236_1179494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096610.1|1179571_1180408_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_040103929.1|1180534_1180666_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010673	Phaeobacter gallaeciensis strain P75 chromosome, complete genome	3811156	1544911	1612519	3811156	protease,portal,head,tRNA,tail,capsid	uncultured_Mediterranean_phage(22.22%)	65	NA	NA
WP_024096945.1|1544911_1546204_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.9	8.6e-87
WP_024096946.1|1546313_1547810_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_024096947.1|1547989_1548274_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	53.8	2.0e-20
WP_024096948.1|1548308_1549970_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	24.0	1.6e-05
WP_024096949.1|1549972_1550941_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	48.7	4.7e-61
WP_024096950.1|1551107_1551461_+	membrane protein	NA	NA	NA	NA	NA
WP_024096951.1|1551558_1552185_+	heme ABC exporter ATP-binding protein CcmA	NA	G9BWD6	Planktothrix_phage	29.2	2.0e-09
WP_024096952.1|1552181_1552838_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_024096953.1|1552883_1553615_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_040104006.1|1553614_1553785_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_024096955.1|1553777_1554317_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_024096956.1|1554392_1554692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096957.1|1554967_1557655_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_024096958.1|1557900_1558632_+	DUF1223 domain-containing protein	NA	NA	NA	NA	NA
WP_024096959.1|1558646_1559582_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_024096960.1|1559952_1561149_-	flagellar motor switch protein	NA	NA	NA	NA	NA
WP_024096961.1|1561225_1561831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096962.1|1562020_1563325_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.2	1.1e-17
WP_024096963.1|1563604_1564861_-	OsmC family protein	NA	NA	NA	NA	NA
WP_024096964.1|1564956_1565517_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024096965.1|1565592_1566936_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_024096966.1|1567123_1567882_+	DUF3445 domain-containing protein	NA	NA	NA	NA	NA
WP_024096967.1|1567919_1568945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096968.1|1569486_1570893_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_014874894.1|1570986_1571325_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024096969.1|1571517_1573209_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_024096970.1|1573583_1575788_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.3e-13
WP_024096971.1|1576197_1577328_+	porin	NA	NA	NA	NA	NA
WP_024096972.1|1577585_1578917_+	trigger factor	NA	NA	NA	NA	NA
WP_024096973.1|1579131_1580400_-	hemolysin-type calcium-binding protein	NA	M4SNJ8	Pseudoalteromonas_phage	25.9	2.8e-05
WP_024096974.1|1580698_1582657_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_024096975.1|1582805_1583276_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024096976.1|1583588_1583771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096977.1|1584003_1584618_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005982441.1|1584630_1584858_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014874885.1|1584886_1585240_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_040103985.1|1585765_1586362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014874883.1|1586600_1587176_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024096979.1|1587300_1587600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024096980.1|1587871_1588663_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_024096981.1|1588815_1590117_-	cytochrome b561	NA	NA	NA	NA	NA
WP_024096982.1|1590302_1591235_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024096983.1|1591319_1592057_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_005982462.1|1592691_1592925_+	acyl carrier protein	NA	A0A2C9CX86	Yersinia_phage	52.1	7.3e-05
WP_024096984.1|1593089_1593833_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
WP_024096985.1|1594016_1595030_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024096986.1|1595289_1596555_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024096987.1|1596554_1597709_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024096988.1|1598000_1598336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096989.1|1598313_1599606_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	41.4	3.9e-71
WP_024096990.1|1599809_1601003_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.9	3.1e-59
WP_024096991.1|1600995_1601214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096992.1|1601249_1601867_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	56.2	1.8e-34
WP_024096993.1|1601915_1603100_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	3.3e-61
WP_043939826.1|1603289_1603934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024096995.1|1603930_1604302_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024096996.1|1604298_1604712_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024096997.1|1604816_1605230_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_024096998.1|1605244_1605598_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_024096999.1|1605594_1605852_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024097000.1|1605844_1606501_+|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	36.6	1.7e-14
WP_024097001.1|1606516_1607149_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	50.0	2.0e-57
WP_024097002.1|1607148_1608099_+	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	35.8	2.5e-51
WP_024097003.1|1608095_1608566_+	phage cell wall peptidase NlpC/P60 family	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.1	2.3e-29
WP_024097004.1|1608565_1612519_+|tail	phage tail protein	tail	A0A0B5A7K5	Paracoccus_phage	37.5	6.4e-226
>prophage 3
NZ_CP010673	Phaeobacter gallaeciensis strain P75 chromosome, complete genome	3811156	1813258	1841222	3811156	protease,portal,head,terminase,tail,capsid,integrase	Ruegeria_phage(23.53%)	42	1806452:1806466	1828412:1828426
1806452:1806466	attL	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_096705123.1|1813258_1814338_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A240F4W2	Ochrobactrum_phage	33.0	9.2e-50
WP_024097174.1|1814631_1815285_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	45.5	6.4e-30
WP_024097175.1|1815306_1815483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096596809.1|1815718_1816417_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	45.0	2.0e-29
WP_024097178.1|1816490_1816637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097179.1|1816693_1817083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052440150.1|1817112_1819200_-	hypothetical protein	NA	A0A1X9HVK8	Ruegeria_phage	59.7	4.6e-215
WP_024097179.1|1819256_1819646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331592.1|1819670_1820417_-	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	52.9	1.1e-57
WP_024097181.1|1820447_1821221_-	hypothetical protein	NA	A0A068CE44	Rhizobium_phage	28.8	3.6e-08
WP_024097182.1|1821369_1821699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097183.1|1821698_1821938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097184.1|1821934_1822249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097185.1|1822445_1822931_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_024097186.1|1822940_1823870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104019.1|1823942_1824593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024097189.1|1825018_1825459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097190.1|1825455_1825623_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043939781.1|1825666_1825993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097192.1|1826271_1826865_+	SAM-dependent methyltransferase	NA	A0A218MLE3	uncultured_virus	48.3	1.3e-42
WP_024097193.1|1826861_1827773_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024097194.1|1827772_1828087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097195.1|1828079_1828742_+	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	60.5	4.4e-55
1828412:1828426	attR	CCAGCAACTCAAAGC	NA	NA	NA	NA
WP_024097196.1|1828751_1829168_+	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	42.9	2.6e-08
WP_024097197.1|1829236_1829617_+	hypothetical protein	NA	A0A1X9HVL1	Ruegeria_phage	35.1	1.5e-07
WP_024097198.1|1829616_1831305_+	DEAD/DEAH box helicase	NA	A0A1X9HX80	Ruegeria_phage	47.6	6.3e-138
WP_024097199.1|1831294_1831873_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_081731415.1|1832067_1832292_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_024097200.1|1832294_1832486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957933.1|1832482_1832809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097202.1|1832984_1833392_+|terminase	phage terminase small subunit	terminase	NA	NA	NA	NA
WP_024097203.1|1833369_1835148_+|terminase	phage terminase-like protein, large subunit	terminase	B0VK29	Azospirillum_phage	40.5	6.9e-119
WP_024097204.1|1835155_1836406_+|portal	phage portal protein	portal	A0A141GEV9	Brucella_phage	52.9	3.4e-104
WP_024097205.1|1836383_1837220_+|protease	Clp protease ClpP	protease	A0A141GEW1	Brucella_phage	73.9	8.5e-112
WP_024097206.1|1837236_1838475_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	55.6	2.1e-127
WP_024097207.1|1838535_1838676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097208.1|1838682_1839252_+	hypothetical protein	NA	A0A141GEW4	Brucella_phage	43.1	3.1e-33
WP_024097209.1|1839251_1839578_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024097210.1|1839574_1840030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097211.1|1840029_1840383_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024097212.1|1840427_1840715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097213.1|1840775_1841222_+	hypothetical protein	NA	A0A2I7RB20	Vibrio_phage	32.0	5.9e-11
>prophage 4
NZ_CP010673	Phaeobacter gallaeciensis strain P75 chromosome, complete genome	3811156	2321377	2330971	3811156	terminase	Vibrio_phage(25.0%)	13	NA	NA
WP_024097662.1|2321377_2322220_-	hypothetical protein	NA	I3PUX5	Vibrio_phage	31.1	3.7e-14
WP_024097663.1|2322233_2324225_-	hypothetical protein	NA	I3PUX6	Vibrio_phage	39.6	3.6e-124
WP_024097664.1|2324221_2325559_-|terminase	phage terminase large subunit	terminase	F8TUR5	EBPR_podovirus	71.8	6.2e-181
WP_024097665.1|2325539_2325842_-	hypothetical protein	NA	A0A088FAU1	Sulfitobacter_phage	41.6	1.5e-05
WP_024097666.1|2326469_2327060_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_040104067.1|2327328_2327715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097669.1|2327726_2328080_-	HNH endonuclease	NA	A0A0B4N249	Escherichia_phage	49.0	5.5e-20
WP_024097670.1|2328148_2328619_-	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	81.7	4.4e-49
WP_024097671.1|2328618_2328987_-	ATPase involved in DNA replication initiation	NA	NA	NA	NA	NA
WP_024097672.1|2328983_2329352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097673.1|2329338_2330136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024097674.1|2330132_2330666_-	T5domain protein	NA	A0A088F856	Sulfitobacter_phage	52.3	2.6e-45
WP_024097675.1|2330662_2330971_-	VRR-NUC domain protein	NA	E2GLY0	Acinetobacter_phage	55.7	1.6e-20
>prophage 5
NZ_CP010673	Phaeobacter gallaeciensis strain P75 chromosome, complete genome	3811156	2334710	2337997	3811156		Pseudoalteromonas_phage(16.67%)	7	NA	NA
WP_024097687.1|2334710_2335379_+	ERF family protein	NA	A0A0H4A6R9	Pseudoalteromonas_phage	48.9	9.1e-24
WP_096705125.1|2335368_2336073_+	3'-5' exonuclease	NA	X2CYL5	Brucella_phage	45.3	1.3e-41
WP_024097689.1|2336072_2336261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024097690.1|2336260_2336551_+	hypothetical protein	NA	A0A0B5HDX4	Vibrio_phage	59.8	6.5e-27
WP_024097691.1|2336564_2337020_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	29.2	2.0e-06
WP_040104145.1|2337088_2337394_+	DUF1364 domain-containing protein	NA	A0A088F868	Sulfitobacter_phage	60.4	7.3e-29
WP_024097693.1|2337415_2337997_+	hypothetical protein	NA	K4NZ13	Pseudomonas_phage	55.2	2.7e-16
>prophage 1
NZ_CP010675	Phaeobacter gallaeciensis strain P75 plasmid pP75_b, complete sequence	171534	111138	160097	171534	transposase,integrase	Vibrio_phage(33.33%)	47	112774:112833	154177:154322
WP_024099411.1|111138_112773_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
112774:112833	attL	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGAT	NA	NA	NA	NA
WP_007803148.1|112902_113565_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052440151.1|113842_114832_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705159.1|114910_115219_-	universal stress protein	NA	NA	NA	NA	NA
WP_082032859.1|115808_116069_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_040104548.1|116232_116538_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158524501.1|116677_117619_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096705141.1|117681_118392_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_082032860.1|118485_119037_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040104532.1|120425_121664_-	amidohydrolase	NA	NA	NA	NA	NA
WP_040104531.1|121684_121984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104533.1|121970_122312_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_040104530.1|122558_122903_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705142.1|122899_123838_-	EamA family transporter	NA	NA	NA	NA	NA
WP_096705143.1|123865_124309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040104538.1|124322_125195_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096705144.1|125311_126448_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096705145.1|126488_127427_-	oxidoreductase	NA	NA	NA	NA	NA
WP_096705146.1|127567_128713_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_040104545.1|128840_130121_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_096705147.1|130432_131008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096705148.1|131208_133059_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_096705149.1|133279_134269_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_040104543.1|134580_135048_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705150.1|135529_136564_-	dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	31.2	1.5e-20
WP_096705151.1|136563_138333_-	acetolactate synthase	NA	G8DDL3	Micromonas_pusilla_virus	24.4	8.6e-05
WP_096705152.1|138466_139318_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_007803185.1|139444_140923_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_040545992.1|140979_141735_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040104559.1|141843_142563_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_008335453.1|142580_143258_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_076626053.1|143254_144454_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_158524502.1|144459_145377_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096705153.1|145452_146235_+	3-oxoadipate enol-lactonase	NA	A0A023W7H4	Mycobacterium_phage	34.6	1.2e-06
WP_065818607.1|146231_146612_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_096705154.1|146611_147340_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_096705155.1|147341_147947_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_096705156.1|148018_149083_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_096705157.1|149214_149940_-	HAD family hydrolase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	29.7	2.8e-10
WP_096705158.1|150056_150878_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.7	3.6e-46
WP_007803196.1|150870_151662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024099410.1|151658_152540_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024099411.1|152541_154176_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_007803209.1|155082_156477_+	membrane protein	NA	NA	NA	NA	NA
154177:154322	attR	CAATATTTGCCACACGAAGCTGCGAACCCTGTCTCAGGTTTAAGGGCAAAAATATCGGATTTAAAGGCAAAATATCATATTTAAGGGCAAAGCAAGGCCGTTGATTTCGTTGGATTTCTCATCTCACAATTAAGGGCTACGCGACA	NA	NA	NA	NA
WP_007803213.1|157407_158199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007803215.1|158195_159074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_007803217.1|159164_160097_-|transposase	IS5-like element ISRhba5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	37.5	2.5e-51
