The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	13818	56914	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	41	NA	NA
WP_006014241.1|13818_14820_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_129827230.1|15108_15768_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.6	2.2e-46
WP_129827231.1|15962_16262_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827232.1|16291_17164_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827233.1|17750_19022_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096560668.1|19474_20695_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.2	1.7e-47
WP_096641402.1|20694_21876_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_006014258.1|21923_22370_+	heme biosynthesis protein HemY	NA	A0A2H4N7M3	Lake_Baikal_phage	36.9	9.7e-14
WP_006014261.1|22396_23071_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	8.0e-28
WP_006014264.1|23100_23325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014267.1|23317_24016_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006014270.1|24150_25338_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	32.1	5.4e-27
WP_006014273.1|25540_26263_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_039950656.1|26263_26800_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_096560667.1|26846_27314_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006014286.1|27662_28640_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_096560603.1|29075_30347_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|30933_31806_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013045.1|31955_33002_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_006013084.1|33143_33842_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_006013081.1|33971_34280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096560649.1|34338_35265_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_006014305.1|35514_36975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014307.1|36979_37588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014310.1|37584_38373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014313.1|38527_39010_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	60.3	2.0e-36
WP_006014316.1|39019_39898_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006014318.1|39890_40475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|40776_41649_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|42235_43507_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_063630856.1|44316_45642_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_096560644.1|45777_46602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014358.1|46726_48253_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_136122016.1|48925_49360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014364.1|49361_50153_+	peptidase M61	NA	NA	NA	NA	NA
WP_006014367.1|50218_50473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|50514_51387_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|52685_53774_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827235.1|53784_54327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|54363_55452_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014381.1|55651_56914_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	34.5	4.1e-65
>prophage 3
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	147910	194342	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(20.0%)	45	NA	NA
WP_006014650.1|147910_150415_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	37.9	1.3e-163
WP_006014654.1|150419_151010_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	33.6	1.2e-08
WP_006014656.1|151062_151389_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006014658.1|151388_151685_-	integration host factor subunit alpha	NA	NA	NA	NA	NA
WP_006014663.1|151723_152920_-	MFS transporter	NA	NA	NA	NA	NA
WP_129827232.1|153652_154525_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827238.1|154792_155014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013179.1|155083_155386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013182.1|155522_155750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827239.1|156035_157355_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|157534_158623_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096641400.1|158649_159198_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006014667.1|159325_160330_-	PRANC domain-containing protein	NA	NA	NA	NA	NA
WP_145510623.1|161133_162006_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013222.1|163022_163379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827241.1|163510_164782_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|165368_166241_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015237.1|166522_167569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015235.1|167821_168439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_006015234.1|168438_169407_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_096641427.1|169589_170516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015230.1|170716_174037_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	34.1	4.5e-164
WP_096641428.1|174085_174859_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_039950823.1|174858_175137_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_006015225.1|175140_175665_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_006015222.1|175777_177070_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.6	2.7e-16
WP_143697328.1|177375_177507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827230.1|177592_178252_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.6	2.2e-46
WP_129827231.1|178446_178746_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_006013981.1|178860_180135_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_006013980.1|180177_181374_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129827239.1|181634_182954_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006015211.1|183247_183538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015587954.1|183534_184080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015205.1|184163_184499_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_129827310.1|184755_184917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950817.1|185421_186000_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006015200.1|186271_186742_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	33.9	2.7e-14
WP_006015198.1|186738_187992_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	26.7	9.7e-27
WP_039950813.1|187988_188375_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_096560656.1|188397_189057_-	CADD family putative folate metabolism protein	NA	NA	NA	NA	NA
WP_129827242.1|189238_189601_+	type IV secretion protein Dot	NA	NA	NA	NA	NA
WP_096616077.1|189809_190898_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827311.1|191725_192100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|193469_194342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	205071	280600	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(28.57%)	52	NA	NA
WP_096676677.1|205071_205944_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015142.1|205973_207473_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006015139.1|207604_208831_+	cytochrome b/b6	NA	NA	NA	NA	NA
WP_006015136.1|208830_209592_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006015133.1|209678_211613_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_096616077.1|212164_213253_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015122.1|213303_214395_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_129827243.1|214655_215882_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_080589545.1|215910_216270_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_006015115.1|216331_216904_+	NifU family protein	NA	A0A218MN08	uncultured_virus	31.5	4.3e-06
WP_006015112.1|216900_218124_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.8	6.1e-26
WP_006015109.1|218120_218891_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	28.7	3.5e-27
WP_006015105.1|219102_220512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015102.1|220637_221912_+	amino acid permease	NA	NA	NA	NA	NA
WP_006015099.1|221982_223269_+	amino acid permease	NA	NA	NA	NA	NA
WP_006015096.1|223297_223723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015092.1|223861_224884_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039950789.1|224885_225962_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_039950787.1|226068_226473_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_006015083.1|226675_228274_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006015082.1|228404_229250_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_006015080.1|229246_229660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|229869_230742_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827312.1|231050_231917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|232524_233397_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827245.1|234825_235362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|235408_236281_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015057.1|236909_238487_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006015054.1|238551_238848_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_006015049.1|238857_241263_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_006015045.1|241255_243829_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_006015043.1|243846_246237_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_039950782.1|246233_249107_+	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_039950780.1|249188_252422_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_006015036.1|252405_253035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|253358_254402_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_096676677.1|255726_256599_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|257185_258457_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006015015.1|258724_260464_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.2	2.7e-67
WP_006015006.1|261129_262452_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_006015001.1|262888_266137_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.0	4.3e-175
WP_006014998.1|266178_268950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014995.1|268946_271286_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006014992.1|271398_271668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014988.1|271868_272594_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_006014985.1|272653_272881_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_006014971.1|272884_273364_+	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
WP_006014968.1|273371_273848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096641398.1|275424_276420_+	heme A synthase	NA	NA	NA	NA	NA
WP_006014957.1|276402_278382_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_006014954.1|278443_279094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014952.1|279247_280600_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	287407	352230	1483853	transposase,tRNA,protease	Bacillus_virus(18.18%)	53	NA	NA
WP_096676677.1|287407_288280_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014920.1|289141_289642_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_006014918.1|289642_290854_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.1e-79
WP_006014915.1|290957_291275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014912.1|291271_292546_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	33.1	3.0e-52
WP_006014910.1|292547_293156_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.0	1.6e-35
WP_006014907.1|293292_293829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|295392_296265_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014897.1|296510_299009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014896.1|299005_299392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950762.1|299384_300881_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_006014888.1|301227_301788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014886.1|301877_303926_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_006014883.1|303934_305590_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	35.0	1.6e-85
WP_006014880.1|305685_306051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014877.1|306140_306785_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_006014874.1|306790_307570_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006014871.1|307660_308734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827248.1|308967_310287_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_039950755.1|310423_313252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014858.1|313232_315587_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_039950758.1|315638_316004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014852.1|316108_317554_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_006014849.1|317658_318699_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_006014846.1|318704_319226_-	cytochrome b	NA	NA	NA	NA	NA
WP_006014843.1|319491_320664_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_129827232.1|320799_321672_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|321897_323169_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|323862_324951_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827313.1|325451_326498_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	5.8e-166
WP_006014834.1|328006_328777_-	response regulator transcription factor	NA	A0A0K0PVG9	Roseobacter_phage	41.3	6.0e-11
WP_006014776.1|329099_330077_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_096560653.1|330096_330579_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_006014768.1|330568_331360_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006014755.1|331395_332532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014752.1|332535_333324_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_007302008.1|333378_333837_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_006014745.1|333830_334229_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_006014742.1|334228_335413_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_006014739.1|335651_336125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|336572_337445_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014725.1|338365_339136_+	polysaccharide deacetylase family protein	NA	A0A2I2L4G0	Orpheovirus	26.2	2.9e-05
WP_006014723.1|339156_340713_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_006014721.1|340812_343269_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.6	1.2e-193
WP_006014718.1|343284_344562_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.4	9.0e-105
WP_039950743.1|344561_345188_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.9	1.3e-61
WP_006014712.1|345199_346543_-	trigger factor	NA	NA	NA	NA	NA
WP_006014710.1|347035_347635_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_006014706.1|347801_348008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014704.1|348067_348226_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_006014702.1|348345_349197_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_096560603.1|349499_350771_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|351357_352230_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	368447	426626	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(36.36%)	48	NA	NA
WP_006014688.1|368447_369398_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_039950731.1|370826_372107_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.4	9.4e-102
WP_006014685.1|372140_373412_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_039950729.1|373642_374113_-	transporter	NA	NA	NA	NA	NA
WP_006014682.1|374247_375675_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_129827231.1|376410_376710_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_096676677.1|376816_377689_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014667.1|378228_379233_+	PRANC domain-containing protein	NA	NA	NA	NA	NA
WP_096641400.1|379360_379909_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096676677.1|380754_381627_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|382213_383485_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006013634.1|383791_385132_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096676677.1|385800_386673_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827249.1|387859_388732_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827250.1|388758_389505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|389531_390620_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013625.1|391245_392259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013621.1|392354_392726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013619.1|392726_392999_+	DUF2610 domain-containing protein	NA	NA	NA	NA	NA
WP_006013616.1|393009_393852_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_006013614.1|393890_394301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013610.1|394497_396297_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_006013606.1|396268_398593_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013603.1|398843_399452_-	guanylate kinase	NA	E7DUI8	Liberibacter_phage	32.4	3.4e-17
WP_039950511.1|399487_401254_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_006013597.1|401237_402221_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013595.1|402874_403780_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.5	1.6e-26
WP_006013592.1|403860_404877_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_129827246.1|405773_406817_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_129827252.1|406866_408000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013579.1|408083_408869_-	NAD kinase	NA	NA	NA	NA	NA
WP_006013575.1|408890_409103_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006013569.1|409227_410196_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_039950503.1|410247_411003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013563.1|411017_412514_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_096641492.1|412710_413445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013556.1|413814_416454_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.8	2.8e-76
WP_006013553.1|416672_417629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013551.1|417918_418680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013549.1|418891_419335_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_006013548.1|419433_419640_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006013542.1|419661_420027_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_039950500.1|420046_420946_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.2	1.6e-10
WP_080589541.1|420985_421279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013536.1|421316_422837_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.2	3.1e-67
WP_096616077.1|423017_424106_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827253.1|424171_425452_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|425537_426626_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 7
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	430961	492508	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(13.33%)	56	NA	NA
WP_129827246.1|430961_432005_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006013510.1|432825_433746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950492.1|433733_435032_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_006013506.1|435028_435523_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006013504.1|435909_436371_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_006013501.1|436385_437117_+	DsbA family protein	NA	NA	NA	NA	NA
WP_017532317.1|437145_437424_-	DUF2671 domain-containing protein	NA	NA	NA	NA	NA
WP_006013497.1|437674_438352_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	32.1	1.7e-17
WP_006013494.1|438323_438977_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_006013492.1|438973_439183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013489.1|439356_440940_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.5	8.8e-41
WP_015588155.1|440943_441276_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006013486.1|441612_442299_+	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_006013484.1|442569_443463_+	sigma-70 family RNA polymerase sigma factor	NA	A0A248SJA5	Salicola_phage	29.0	1.0e-25
WP_006013483.1|443455_443953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096560624.1|444064_445216_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	36.6	4.7e-52
WP_006013481.1|445217_445955_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_006012936.1|446068_447136_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.2	8.6e-117
WP_129827239.1|447396_448716_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006013480.1|448947_449502_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_006013479.1|449501_450113_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_129827249.1|451095_451968_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013473.1|452128_453013_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_006013471.1|453210_454413_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.8e-46
WP_006013469.1|454437_455220_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006013467.1|455336_456575_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_006013465.1|456706_457246_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	1.2e-21
WP_006013463.1|457235_458009_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	30.2	1.9e-12
WP_006013459.1|458520_459048_+	demethoxyubiquinone hydroxylase family protein	NA	NA	NA	NA	NA
WP_006013456.1|459175_460408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013453.1|460658_462044_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.9	7.4e-52
WP_006013441.1|462766_463054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013437.1|463074_463395_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_039950484.1|463523_464339_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_006013430.1|464325_465090_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	2.9e-10
WP_145510633.1|465206_468410_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_096676677.1|468835_469708_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013351.1|469796_470750_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.8	4.8e-10
WP_039950469.1|472602_474627_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_129827232.1|474831_475704_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013335.1|476141_476822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013332.1|476847_477441_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.2	1.3e-29
WP_006013329.1|477543_478116_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006013327.1|478121_479840_+	potassium transporter	NA	NA	NA	NA	NA
WP_006013324.1|479929_481090_+	aspartate kinase	NA	NA	NA	NA	NA
WP_006013321.1|481107_482187_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_006013317.1|482195_482663_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_006013315.1|482726_483653_+	glutathione synthase	NA	NA	NA	NA	NA
WP_006013311.1|483637_484660_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_039950466.1|484733_485099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013306.1|485100_486486_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	2.5e-44
WP_006013300.1|487174_487654_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_006013294.1|487733_488348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|488447_489320_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|489906_491178_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|491419_492508_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 8
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	497474	661624	1483853	transposase,tRNA,protease	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(21.21%)	116	NA	NA
WP_006013270.1|497474_498587_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_006013267.1|498799_499867_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_039950459.1|499887_501306_-	carboxypeptidase	NA	NA	NA	NA	NA
WP_006013262.1|501577_502057_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006013259.1|502192_503485_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	29.5	1.9e-09
WP_006013256.1|503497_503980_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	47.1	6.4e-11
WP_080589540.1|504139_504625_+	AAA family ATPase	NA	E4WLN5	Ostreococcus_tauri_virus	52.1	8.1e-22
WP_006013250.1|504844_506674_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.9	4.3e-116
WP_096641557.1|506797_507799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013244.1|508035_508530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|508818_509691_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013192.1|510100_511357_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_129827239.1|511869_513189_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|513504_514377_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|514571_515444_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013106.1|515672_517418_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.6	1.1e-15
WP_006013103.1|517699_521305_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013099.1|521415_522426_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	9.8e-62
WP_006013098.1|522497_523235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950406.1|523411_524839_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	32.4	1.7e-27
WP_006013093.1|524903_526073_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	31.0	1.5e-34
WP_096676677.1|527572_528445_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|529031_530303_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827256.1|530353_530539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051008230.1|530537_531107_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006013026.1|531156_532230_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006013023.1|532333_532969_+	chromosomal DNA replication initiator DnaA	NA	NA	NA	NA	NA
WP_006013018.1|533340_534327_+	tyrosine recombinase XerD	NA	Q83VS6	Escherichia_phage	26.6	3.4e-11
WP_039950381.1|534383_535109_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_006013011.1|535152_535422_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_006013009.1|535502_536744_+	citrate synthase	NA	NA	NA	NA	NA
WP_006013005.1|536788_538231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013002.1|538260_538443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|539317_540190_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950357.1|540236_540524_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_039950355.1|540818_542030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012928.1|542296_543286_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	3.0e-07
WP_006012927.1|543282_543855_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_006012925.1|544154_544679_+	cytochrome c family protein	NA	NA	NA	NA	NA
WP_006012924.1|544680_545436_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006012922.1|545478_547392_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	38.2	3.6e-113
WP_006012920.1|547520_547943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012918.1|548135_548723_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_006012916.1|548713_549022_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_006012911.1|549026_550874_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_006012909.1|550877_552320_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_006012907.1|552316_553681_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_006012905.1|553698_554421_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_006012899.1|554538_554940_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_096616077.1|555083_556172_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827257.1|556628_558569_-	hypothetical protein	NA	Q9JML0	Wolbachia_phage	84.6	1.2e-289
WP_006012795.1|559226_561425_-	hypothetical protein	NA	Q9JMK9	Wolbachia_phage	99.2	1.0e-127
WP_006012794.1|561432_562770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012791.1|563743_569674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|574508_575552_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_145556769.1|578971_579892_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	64.4	2.7e-95
WP_006012424.1|580019_580931_+	helix-turn-helix domain-containing protein	NA	A0A1B2LRS2	Wolbachia_phage	37.8	6.8e-46
WP_096676677.1|581397_582270_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827241.1|582856_584128_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827248.1|585746_587066_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827258.1|587052_587292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012009.1|588351_590913_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	35.1	9.3e-125
WP_006012006.1|590940_595602_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006012003.1|595607_595898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012001.1|595869_597246_+	PleD family two-component system response regulator	NA	G3MA91	Bacillus_virus	35.8	2.1e-22
WP_006011997.1|597268_597997_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006011994.1|598193_598742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006011989.1|599221_600289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006011986.1|600384_600603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|600789_601878_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827259.1|601943_602951_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.6	1.1e-161
WP_129827260.1|603124_603352_-	hypothetical protein	NA	A0A0U4B0A1	Bacillus_phage	68.4	6.9e-08
WP_129827261.1|604702_605575_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827262.1|605772_607452_+	latrotoxin-related protein	NA	NA	NA	NA	NA
WP_129827263.1|607668_608541_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950809.1|608903_609791_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_006015187.1|609794_610145_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_006015184.1|610154_612476_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.7	7.1e-23
WP_096560606.1|612483_614037_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_096616077.1|616708_617797_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014820.1|618563_619268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014818.1|619271_620009_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_006014815.1|620335_621718_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_006014812.1|621875_622748_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.9	3.0e-43
WP_006014805.1|623161_623503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014802.1|623543_624068_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_006014799.1|624181_625891_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_006014796.1|625868_626297_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	36.8	4.2e-14
WP_006014794.1|626296_626779_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_096560728.1|626879_627524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014782.1|627591_628053_-	dUTP diphosphatase	NA	A0A1Q1PNN8	Noumeavirus	54.8	2.5e-36
WP_129827232.1|628770_629643_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|630229_631501_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006014342.1|631767_632952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006014335.1|633109_633709_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_006014332.1|633695_634643_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	46.5	1.3e-68
WP_096616077.1|634736_635825_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827264.1|635890_637153_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|637739_638612_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827265.1|638891_641105_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006013682.1|642304_642790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|643272_644145_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827241.1|644731_646003_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827266.1|646121_646877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827246.1|647289_648333_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_006013418.1|648741_650163_-	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PHP6	Moraxella_phage	24.9	1.0e-19
WP_006013415.1|650159_650891_-	metal ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	22.5	1.2e-05
WP_039950476.1|650882_651758_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_006013410.1|652117_652414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012481745.1|653123_653324_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_096560696.1|653473_655222_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_006013401.1|655295_657218_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	9.6e-151
WP_096641459.1|657290_657575_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006013396.1|657582_658815_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_039950474.1|658783_660373_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_006013385.1|660739_661624_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	669905	739358	1483853	transposase,tRNA,head,protease	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(27.78%)	52	NA	NA
WP_096616077.1|669905_670994_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006011971.1|671343_672669_+	dihydroorotase	NA	NA	NA	NA	NA
WP_096560695.1|672753_673938_+	ribonuclease D	NA	A0A0M5KJQ5	Mollivirus	28.9	6.8e-06
WP_006013234.1|673927_674506_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_096676677.1|674551_675424_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|676010_677282_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827233.1|677879_679151_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827267.1|679548_679749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|680086_680959_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827268.1|681545_682808_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|683129_684218_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013953.1|684660_684888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080589543.1|684992_685301_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013958.1|685297_686287_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1B1IW95	uncultured_Mediterranean_phage	56.1	2.7e-104
WP_006013961.1|686418_686757_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006013963.1|686928_687285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013965.1|687402_688932_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	40.1	2.3e-94
WP_129827231.1|689200_689500_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827269.1|689496_690354_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_006013948.1|690800_692204_-	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_129827270.1|692420_693692_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827271.1|694278_695151_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096616077.1|696037_697126_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006013657.1|699782_700541_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	43.9	9.9e-51
WP_006013653.1|700544_701516_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006013649.1|701667_702027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013646.1|702270_703119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827271.1|703683_704556_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827270.1|705142_706414_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006013670.1|706706_707240_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	45.2	5.6e-32
WP_096560733.1|707341_709504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|709530_710619_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096560729.1|710693_711911_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2L0UZ92	Agrobacterium_phage	36.0	3.2e-51
WP_007302691.1|712244_714074_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	40.8	8.0e-22
WP_006013690.1|714295_715630_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	34.9	1.3e-13
WP_006013692.1|715748_716768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013694.1|716773_716956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013696.1|717070_717880_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_006013698.1|717873_718221_-	membrane protein	NA	NA	NA	NA	NA
WP_006013700.1|718224_719091_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_006013703.1|719165_722435_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	25.3	3.2e-13
WP_096676677.1|724989_725862_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827232.1|726450_727323_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013710.1|727717_728731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096641461.1|728738_729086_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_006013719.1|731219_732518_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_006013721.1|732616_734350_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.4	7.5e-62
WP_006013724.1|734495_735662_+	multifunctional ribose 5-phosphate isomerase B/3-demethylubiquinone-9 3-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	A0A2K9L4K8	Tupanvirus	33.9	3.6e-07
WP_006013725.1|735769_736900_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_039950529.1|736899_737505_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_129827314.1|737516_738011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|738269_739358_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 10
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	742910	885810	1483853	transposase,integrase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(31.25%)	114	739120:739179	804800:805072
739120:739179	attL	GTTACAATATTATTTTTCGCAAGAAAATCTACAATTCTTTGGAAGATCTGCAGATAGATG	NA	NA	NA	NA
WP_129827272.1|742910_743783_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827268.1|744369_745632_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|745697_746786_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096560683.1|747859_748882_-	UDP-N-acetylmuramate--alanine ligase	NA	NA	NA	NA	NA
WP_039950541.1|748908_749577_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	52.8	8.0e-20
WP_006013753.1|749801_750437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013756.1|750598_751756_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_006013759.1|751987_752908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013763.1|753115_753622_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.9	6.4e-30
WP_006013766.1|753693_753903_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_006013769.1|753917_754544_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_096641457.1|754533_755229_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	46.5	1.2e-21
WP_096560682.1|757289_758462_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_096560603.1|759151_760423_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|761009_761882_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013790.1|762901_763687_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_129827232.1|763929_764802_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013808.1|766363_767458_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_006013816.1|769041_769965_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_006013819.1|770083_771883_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006013822.1|772157_772895_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	8.2e-26
WP_006013840.1|773035_773203_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_006013842.1|773329_773986_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_006013843.1|774081_774738_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_096560661.1|774730_776125_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9V966	Bandra_megavirus	30.6	5.9e-49
WP_080589542.1|776093_776507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950557.1|776537_779474_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_006013851.1|779466_779904_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	44.8	3.2e-33
WP_006013853.1|780079_780967_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_006013855.1|780968_782519_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	35.0	3.5e-10
WP_006013857.1|782534_783299_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_006013859.1|783855_785367_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006013861.1|785521_785950_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_006013863.1|786015_786996_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_006013868.1|787195_788626_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_096641426.1|788618_789296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013881.1|790353_791274_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.6	1.4e-14
WP_006013883.1|791276_792656_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	8.2e-35
WP_039950562.1|792648_793758_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_039950565.1|794081_795374_+	membrane protein	NA	NA	NA	NA	NA
WP_006013892.1|795491_796139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013894.1|796285_798859_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	50.7	7.1e-250
WP_006013896.1|798900_800976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013899.1|801113_802280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006013901.1|802323_803004_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_096616077.1|804893_805982_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
804800:805072	attR	CATCTATCTGCAGATCTTCCAAAGAATTGTAGATTTTCTTGCGAAAAATAATATTGTAACTGTACTAGACACAACTTAATCTGACAGGCATGAATTAACTGACAGAAGAATTGAGGTAGTTAAAACTAATATCAGTCTCTTGTTTCATGCTACTAATATTTTTCTGAAAAGCAATGTGTTTGCTATTAAGAAAAGTCTGAGTAGGCGTTTTGCCATAGCAATATTTGCCTGAATGAGGCCTTGTCTCATTATAAGAACGCAACCAATGATCAA	NA	NA	NA	NA
WP_129827268.1|806967_808230_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|808816_809689_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006013906.1|810274_811036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950580.1|811271_812066_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_006013910.1|812062_812821_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	5.9e-19
WP_129827273.1|812889_813594_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_129827315.1|813685_814732_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	1.3e-165
WP_006013920.1|815231_816410_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_006013922.1|816437_816932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827274.1|817251_818553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827231.1|818587_818887_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_096616077.1|819122_820211_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827275.1|820221_821514_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827276.1|822100_822913_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827277.1|822964_823831_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.7	6.0e-52
WP_006013933.1|824277_825537_+|tRNA	proline--tRNA ligase	tRNA	A0A1V0SEQ8	Hokovirus	22.2	1.8e-12
WP_006013935.1|825533_825908_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_006013937.1|825960_826695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013939.1|826760_827150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006013941.1|827124_827526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560603.1|828205_829477_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|830063_830936_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_108784648.1|831793_832297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827278.1|832456_833662_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_129827279.1|833672_834761_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.9	3.3e-172
WP_006012843.1|835079_835970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950321.1|836608_837934_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_129827280.1|838326_840567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|840577_841666_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_017531625.1|841741_842332_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_006012837.1|842328_842565_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_006012835.1|842667_844605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012833.1|844763_846041_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	31.6	1.4e-52
WP_129827281.1|846221_847739_+	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	50.7	5.2e-83
WP_096616077.1|847793_848882_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006012827.1|849276_850185_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_006012825.1|850189_850783_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_096560709.1|850896_851988_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_129827248.1|852823_854143_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006012815.1|854354_855284_-	permease	NA	NA	NA	NA	NA
WP_129827313.1|855947_856994_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.7	5.8e-166
WP_129827282.1|857085_857286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012806.1|857302_858463_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_096676677.1|859230_860103_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827283.1|860689_861961_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012786.1|862247_862874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012784.1|862890_864171_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_096560603.1|864452_865724_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|867018_868107_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827284.1|868185_868326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007302667.1|868413_868971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950302.1|869152_871264_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	41.6	4.7e-74
WP_006012772.1|871264_871543_-	YggT family protein	NA	NA	NA	NA	NA
WP_129827231.1|872031_872331_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827269.1|872327_873185_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_006012948.1|873283_873712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827269.1|874632_875490_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	2.7e-52
WP_129827285.1|875486_875786_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	31.2	2.5e-05
WP_006012758.1|876061_877075_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_006012755.1|877062_878331_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	2.7e-133
WP_145556772.1|878327_878642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012750.1|878663_879662_-	murC	NA	NA	NA	NA	NA
WP_039950297.1|879671_880283_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_006012742.1|880284_880761_-	bacterioferritin	NA	NA	NA	NA	NA
WP_006012739.1|880814_881288_-	RDD family protein	NA	NA	NA	NA	NA
WP_006012737.1|881287_881926_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_145510642.1|882068_883424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|884721_885810_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 11
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	895790	952931	1483853	transposase,tRNA	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(16.67%)	48	NA	NA
WP_129827279.1|895790_896879_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.9	3.3e-172
WP_039950285.1|896954_897467_+	membrane protein	NA	NA	NA	NA	NA
WP_006012700.1|897889_899008_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	32.4	4.2e-29
WP_006012698.1|899176_900811_+	ribonuclease J	NA	NA	NA	NA	NA
WP_017532676.1|900857_901205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026092717.1|901257_902514_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_006012695.1|902552_902906_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_006012694.1|902895_903816_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.0	1.4e-35
WP_039950277.1|903963_905928_-	transketolase	NA	NA	NA	NA	NA
WP_006012690.1|906041_906656_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_006012689.1|906773_906968_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_006012687.1|907235_907559_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006012685.1|907613_907928_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_006012683.1|907920_908784_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_006012681.1|908882_909401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950275.1|910210_910846_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	47.6	1.1e-37
WP_039950273.1|911874_912672_-	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	42.8	6.0e-30
WP_006012667.1|912773_913184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827276.1|913267_914080_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|914666_915938_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012658.1|916938_917748_-	hypothetical protein	NA	A0A1B2LRR2	Wolbachia_phage	41.2	5.0e-24
WP_006012656.1|917867_919058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012653.1|919698_921036_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	36.8	3.9e-18
WP_006012651.1|921341_922499_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012648.1|922999_923704_-	ComF family protein	NA	NA	NA	NA	NA
WP_006012646.1|923755_926569_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.4	0.0e+00
WP_006012645.1|926894_928220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096641442.1|928280_929279_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	29.5	9.2e-12
WP_006012640.1|929284_929638_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_006012627.1|929837_930620_+	signal peptidase I	NA	NA	NA	NA	NA
WP_006012624.1|930623_932396_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	35.2	2.9e-85
WP_006012616.1|932373_932832_-	molecular chaperone Hsc20	NA	NA	NA	NA	NA
WP_006012614.1|932824_933211_-	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	40.2	2.2e-14
WP_006012607.1|933216_933600_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	3.1e-53
WP_006012604.1|933777_934689_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.3	2.5e-16
WP_129827232.1|935560_936433_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560750.1|937094_937478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012580.1|937606_938404_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_006012576.1|938516_938807_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	35.1	1.1e-10
WP_006012568.1|938886_940545_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	49.3	1.8e-129
WP_129827316.1|941354_942401_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	80.5	3.7e-165
WP_129827287.1|942508_943771_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827232.1|944357_945230_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012557.1|945542_946886_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_006012555.1|946952_948224_-	MFS transporter	NA	NA	NA	NA	NA
WP_129827288.1|948298_948538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012553.1|948958_951409_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	32.3	4.7e-102
WP_096616077.1|951842_952931_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 12
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	981534	1029884	1483853	transposase,tRNA,protease	Wolbachia_phage(61.9%)	44	NA	NA
WP_006012455.1|981534_983235_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006012452.1|983369_983933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012449.1|984018_984267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012446.1|984488_986186_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	6.9e-52
WP_006012444.1|986345_987044_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_051008229.1|987193_988366_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_129827289.1|989222_989687_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_096676677.1|989679_990552_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096676677.1|992011_992884_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827289.1|992876_993341_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_006012414.1|993560_993884_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006012412.1|993900_994119_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_096560671.1|994157_995477_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_006012406.1|995596_996139_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006012402.1|996238_997195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012399.1|997262_997940_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_006012396.1|997947_998688_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096560670.1|998684_999743_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	47.0	1.0e-21
WP_006012389.1|999726_1000596_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_096560669.1|1000763_1001048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1001583_1002456_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950222.1|1004932_1007605_-	pyruvate, phosphate dikinase	NA	A0A2I7QIA2	Vibrio_phage	39.0	2.2e-89
WP_006012372.1|1008048_1008708_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	41.2	1.0e-43
WP_006012370.1|1008817_1009147_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRS2	Wolbachia_phage	41.7	3.9e-12
WP_006012367.1|1009169_1009532_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR8	Wolbachia_phage	37.9	3.4e-09
WP_129827290.1|1009894_1010515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096676677.1|1010935_1011808_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012357.1|1012103_1013594_-	ankyrin repeat domain-containing protein	NA	F8QZT5	Wolbachia_phage	89.5	2.0e-196
WP_039950216.1|1013618_1014083_-	hypothetical protein	NA	A0A1B2LRT3	Wolbachia_phage	87.2	1.1e-63
WP_006012353.1|1014227_1014698_-	hypothetical protein	NA	E9P621	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	74.8	3.1e-63
WP_006012344.1|1015577_1016069_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1B2LRS7	Wolbachia_phage	50.7	1.6e-30
WP_006012341.1|1016120_1016918_+	ATP-binding protein	NA	E9P631	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.5	1.7e-125
WP_096641520.1|1016941_1017430_+	hypothetical protein	NA	A0A1B2LRU0	Wolbachia_phage	66.3	6.6e-56
WP_006012334.1|1017426_1018653_+	AAA family ATPase	NA	A0A1B2LRQ9	Wolbachia_phage	63.0	1.3e-140
WP_006012332.1|1018676_1020731_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	76.9	0.0e+00
WP_039950207.1|1020978_1022091_-	hypothetical protein	NA	Q9JMN2	Wolbachia_phage	61.2	2.4e-130
WP_006012327.1|1022056_1023253_-	hypothetical protein	NA	Q9JMN1	Wolbachia_phage	62.3	1.4e-147
WP_006012324.1|1023448_1023667_+	hypothetical protein	NA	A0A1B2LRU8	Wolbachia_phage	52.9	4.0e-13
WP_129827292.1|1023566_1025249_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	50.3	1.3e-140
WP_096616077.1|1025298_1026387_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006012309.1|1026702_1027437_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.5	2.6e-11
WP_006012302.1|1027532_1027868_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_039950205.1|1027869_1029159_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_006012296.1|1029230_1029884_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	4.1e-37
>prophage 13
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	1056296	1124252	1483853	transposase,tRNA	Staphylococcus_phage(22.22%)	49	NA	NA
WP_129827232.1|1056296_1057169_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012187.1|1057659_1057962_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_006012184.1|1057972_1058242_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_006012172.1|1058366_1059530_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	47.5	4.9e-89
WP_096560655.1|1059632_1060298_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006012167.1|1060337_1060997_+	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006012165.1|1061044_1061872_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_006012163.1|1061872_1062361_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_006012162.1|1062386_1062854_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006012160.1|1062919_1064704_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	58.9	6.1e-200
WP_039950199.1|1064752_1065823_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129827232.1|1069802_1070675_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|1071261_1072533_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012150.1|1073344_1073554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080589533.1|1073627_1074005_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_006012144.1|1073988_1074123_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_006012141.1|1074230_1075319_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_006012138.1|1075406_1076852_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_006012135.1|1076857_1077199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1077984_1078857_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1079443_1080715_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006012123.1|1081278_1081749_-	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_006012113.1|1082605_1083841_-	NTP transferase domain-containing protein	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	29.8	1.4e-17
WP_006012109.1|1083841_1084885_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.4	4.9e-32
WP_039950189.1|1085756_1087724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012104.1|1087764_1088361_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.6	6.0e-27
WP_006012102.1|1088418_1089006_+	CvpA family protein	NA	NA	NA	NA	NA
WP_039950186.1|1089137_1090496_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.6	7.5e-41
WP_096560605.1|1090592_1092602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012089.1|1092792_1094385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012088.1|1094613_1095321_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_006012085.1|1095320_1096148_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_006012082.1|1096140_1097097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827294.1|1098052_1099324_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1099910_1100783_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012066.1|1100815_1103344_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	36.5	6.9e-56
WP_006012063.1|1103447_1104914_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_006012060.1|1105103_1107476_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.0	2.2e-112
WP_129827295.1|1107840_1108713_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012047.1|1109998_1110865_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012044.1|1111099_1111783_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006012041.1|1111779_1112565_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006012038.1|1112573_1113908_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006012035.1|1113910_1115377_+	amino acid carrier protein	NA	NA	NA	NA	NA
WP_006012032.1|1115614_1116190_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_006012029.1|1116184_1117996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012026.1|1118051_1118948_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_096641494.1|1119602_1123088_+	peptidase M2	NA	NA	NA	NA	NA
WP_096616077.1|1123163_1124252_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 14
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	1127700	1272956	1483853	transposase,tRNA,protease,tail	Wolbachia_phage(30.77%)	117	NA	NA
WP_006015767.1|1127700_1129809_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006015765.1|1129812_1130652_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_006015763.1|1130696_1131455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1131594_1132467_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827231.1|1133147_1133447_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	32.3	1.5e-05
WP_129827296.1|1133443_1134301_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	4.6e-52
WP_096560711.1|1134323_1135343_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_039950909.1|1135335_1136361_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_006015761.1|1136344_1138393_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_006015760.1|1138398_1138611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051008240.1|1138828_1140325_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.7e-54
WP_039950913.1|1140421_1141063_-	dioxygenase	NA	NA	NA	NA	NA
WP_006015756.1|1141229_1144370_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_006015754.1|1144497_1147101_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_006015752.1|1147107_1147611_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_006015750.1|1147774_1148434_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_006015748.1|1148448_1149153_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.7	3.6e-39
WP_006015746.1|1149188_1149788_+	SCO family protein	NA	NA	NA	NA	NA
WP_129827234.1|1150694_1151966_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1152552_1153425_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950902.1|1153841_1154534_-	ribonuclease III	NA	A0A0P0YNG1	Yellowstone_lake_phycodnavirus	35.2	1.7e-28
WP_006015737.1|1154626_1155694_-	quinone-dependent dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	25.2	8.6e-16
WP_006015735.1|1155765_1156563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015733.1|1156748_1157639_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_006015731.1|1157697_1158696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015729.1|1158752_1161032_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	39.5	9.4e-145
WP_006015727.1|1161329_1162556_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	8.5e-52
WP_006015726.1|1162590_1162842_-	cold-shock protein	NA	NA	NA	NA	NA
WP_006015725.1|1163017_1164352_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_006015724.1|1164370_1165243_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_006015723.1|1165409_1166630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015721.1|1166626_1167358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015719.1|1167350_1168580_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_129827232.1|1168981_1169854_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006015704.1|1170769_1172008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015702.1|1172084_1172450_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_006015700.1|1172446_1172824_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_039950891.1|1174582_1175200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015696.1|1175677_1175878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096560652.1|1177662_1179546_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.2	3.0e-32
WP_039950889.1|1179685_1179988_-	cation:proton antiporter subunit C	NA	NA	NA	NA	NA
WP_006015683.1|1179987_1180404_-	Na(+)/H(+) antiporter subunit B	NA	NA	NA	NA	NA
WP_006015680.1|1180396_1180924_-	DUF4040 domain-containing protein	NA	NA	NA	NA	NA
WP_006015677.1|1180935_1181208_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_039950888.1|1181214_1181460_-	multiple resistance and pH regulation protein F (MrpF / PhaF) superfamily	NA	NA	NA	NA	NA
WP_006015671.1|1181488_1181881_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_006015668.1|1181941_1182238_-	XRE family transcriptional regulator	NA	A0A0D5BHH6	Escherichia_phage	36.2	2.4e-08
WP_006015665.1|1183096_1183597_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	3.5e-20
WP_006015662.1|1183596_1185426_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	75.3	1.9e-252
WP_039950896.1|1185430_1185700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015657.1|1185832_1186858_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006015654.1|1186860_1187733_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_096641423.1|1187736_1189200_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	4.2e-21
WP_006015648.1|1189521_1193706_+	collagen-like protein	NA	NA	NA	NA	NA
WP_006015645.1|1193710_1195036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|1195300_1196389_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_096616077.1|1197347_1198436_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015629.1|1198625_1198841_-	hypothetical protein	NA	A0A1B2LRU2	Wolbachia_phage	60.6	1.1e-12
WP_006015625.1|1198908_1199442_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006015622.1|1199494_1200439_-|tail	tail protein	tail	A0A1B2LRT8	Wolbachia_phage	74.4	4.0e-134
WP_006015620.1|1200439_1200649_-|tail	tail protein	tail	A0A1B2LRT9	Wolbachia_phage	72.5	1.1e-23
WP_039950887.1|1200645_1200993_-|tail	phage tail protein	tail	A0A1B2LRV9	Wolbachia_phage	74.6	1.4e-44
WP_096560725.1|1200992_1203257_-|tail	phage tail tape measure protein	tail	E9P5Y8	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	61.8	3.6e-221
WP_006015605.1|1203366_1203624_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	95.3	2.1e-37
WP_145556774.1|1203755_1204679_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	96.7	1.6e-151
WP_096641443.1|1204774_1205281_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	99.4	7.7e-92
WP_006015583.1|1207991_1209368_-	hypothetical protein	NA	A0A1B2LRR1	Wolbachia_phage	100.0	1.8e-231
WP_006015580.1|1209364_1209559_-	hypothetical protein	NA	A0A1B2LRW5	Wolbachia_phage	100.0	9.3e-30
WP_006015576.1|1209563_1210760_-	hypothetical protein	NA	A0A1B2LRR4	Wolbachia_phage	99.7	1.1e-224
WP_096616077.1|1212471_1213560_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827297.1|1213609_1214341_-	triosephosphate isomerase	NA	NA	NA	NA	NA
WP_006015557.1|1214515_1215310_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_006015555.1|1215433_1216921_+	IMP dehydrogenase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	40.2	1.3e-41
WP_006015550.1|1217186_1218605_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_006015546.1|1218799_1219402_-	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_006015543.1|1219635_1221435_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_006015540.1|1221569_1221884_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_006015537.1|1221894_1222881_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_006015534.1|1222943_1223504_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_096560685.1|1223519_1224518_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096616077.1|1224682_1225771_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827285.1|1227868_1228168_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	31.2	2.5e-05
WP_129827296.1|1228164_1229022_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.1	4.6e-52
WP_006015517.1|1229353_1232056_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_096616077.1|1232950_1234039_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015498.1|1234120_1234486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015496.1|1234619_1234847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015493.1|1234874_1235309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015490.1|1235519_1236260_-	DsbA family protein	NA	NA	NA	NA	NA
WP_006015487.1|1236599_1238483_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_006015485.1|1238530_1240018_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_006015482.1|1240058_1240586_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	60.3	2.3e-46
WP_129827317.1|1241830_1242877_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.0	7.5e-166
WP_129827298.1|1243460_1244654_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_006015468.1|1244889_1245681_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_006015465.1|1245687_1246137_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.1	3.5e-27
WP_006015458.1|1247240_1247762_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_006015456.1|1247754_1248171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015454.1|1248437_1249004_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	42.9	8.8e-36
WP_039950872.1|1248997_1250320_-	insulinase family protein	NA	NA	NA	NA	NA
WP_006015450.1|1250306_1251638_-	insulinase family protein	NA	NA	NA	NA	NA
WP_006015448.1|1251642_1252119_-	signal peptidase II	NA	NA	NA	NA	NA
WP_006015446.1|1252115_1253048_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_006015443.1|1253118_1253490_+	glutaredoxin	NA	NA	NA	NA	NA
WP_006015439.1|1253585_1254458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015434.1|1254698_1256495_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	40.7	8.2e-19
WP_006015428.1|1257683_1259060_-	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_006015425.1|1259342_1260035_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	33.8	2.7e-26
WP_006015419.1|1260255_1261818_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	25.5	1.3e-07
WP_006015416.1|1262045_1263506_-	secretion system protein	NA	NA	NA	NA	NA
WP_129827248.1|1264199_1265519_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096676677.1|1265865_1266738_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1267324_1268596_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_006015382.1|1269818_1270529_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_006015380.1|1270671_1271490_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_006015378.1|1271559_1271688_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_096676677.1|1272083_1272956_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	1276635	1431088	1483853	transposase,tRNA	Wolbachia_phage(28.21%)	113	NA	NA
WP_145510659.1|1276635_1277724_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.5	5.1e-173
WP_006013054.1|1278086_1278335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1278967_1279840_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1280426_1281698_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_039950853.1|1282169_1282331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015355.1|1282405_1283632_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_006015353.1|1283691_1284651_+	P44/Msp2 family outer membrane protein	NA	NA	NA	NA	NA
WP_129827233.1|1284917_1286189_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|1287533_1288622_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827300.1|1288828_1289023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015341.1|1289165_1290671_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_006015339.1|1290743_1291118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015337.1|1291236_1292115_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_096560746.1|1292105_1292990_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_006015333.1|1293057_1294242_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_006015331.1|1294238_1294829_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_096616077.1|1295833_1296922_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006015319.1|1297548_1299504_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	37.6	6.4e-102
WP_129827301.1|1299760_1300702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616077.1|1300722_1301811_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_145556778.1|1302601_1303372_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096616077.1|1303421_1304510_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_039950839.1|1304792_1305551_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_006015304.1|1305531_1306485_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_006015300.1|1307048_1307315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950835.1|1307344_1307722_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_006015295.1|1307783_1308869_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.2	3.6e-30
WP_096616077.1|1310027_1311116_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827303.1|1311093_1311396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015279.1|1311526_1314178_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006015276.1|1314403_1315477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006015273.1|1315646_1316450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039950829.1|1316550_1317711_+	porin	NA	NA	NA	NA	NA
WP_006015267.1|1317974_1319315_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_096560716.1|1319347_1320454_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.4	7.0e-45
WP_096560717.1|1321106_1321799_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	41.8	4.4e-45
WP_006015253.1|1322985_1324227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006015251.1|1324373_1326464_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_006015248.1|1326514_1328848_-	ankyrin repeat domain-containing protein	NA	Q9JML0	Wolbachia_phage	36.2	2.8e-67
WP_006015245.1|1328961_1331445_+	DNA mismatch repair protein MutS	NA	A0A2H4UUR2	Bodo_saltans_virus	21.6	8.6e-35
WP_129827233.1|1331956_1333228_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1334022_1334895_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129827234.1|1335481_1336753_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827304.1|1336803_1337082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006012858.1|1337562_1338933_-	magnesium transporter	NA	NA	NA	NA	NA
WP_096641467.1|1339087_1340188_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_039950324.1|1340363_1341617_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_006012864.1|1341812_1344110_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_006012865.1|1344229_1345153_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_006012867.1|1345160_1346423_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	1.7e-34
WP_096560736.1|1346600_1346735_+	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	64.7	9.3e-05
WP_129827263.1|1346731_1347604_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1347950_1349222_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1349808_1350681_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096641534.1|1350673_1351198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006012875.1|1351262_1353071_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	23.6	7.2e-07
WP_096676677.1|1353577_1354450_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560603.1|1355036_1356308_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_129827263.1|1356654_1357527_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096560736.1|1357523_1357658_-	hypothetical protein	NA	A0A1U9WQS3	Geobacillus_phage	64.7	9.3e-05
WP_006012867.1|1357835_1359098_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.1	1.7e-34
WP_006012865.1|1359105_1360029_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_006012864.1|1360148_1362446_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_039950324.1|1362641_1363895_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_096641467.1|1364069_1365171_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_006012858.1|1365325_1366696_+	magnesium transporter	NA	NA	NA	NA	NA
WP_129827304.1|1367176_1367455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129827234.1|1367505_1368777_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096676677.1|1369363_1370236_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006012884.1|1371031_1371337_+	hypothetical protein	NA	Q9JMM1	Wolbachia_phage	76.2	9.2e-40
WP_129827249.1|1371437_1372310_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_136122018.1|1372525_1374469_-	hypothetical protein	NA	Q9JML0	Wolbachia_phage	84.8	7.2e-287
WP_129827246.1|1388069_1389113_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	82.4	6.1e-168
WP_145556776.1|1389334_1390234_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	61.9	5.2e-83
WP_006014015.1|1390362_1391292_+	helix-turn-helix domain-containing protein	NA	A0A1B2LRR8	Wolbachia_phage	57.3	6.2e-79
WP_006014017.1|1391463_1392120_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	60.5	7.0e-69
WP_006014019.1|1392218_1393406_+	hypothetical protein	NA	A0A1B2LRQ6	Wolbachia_phage	82.7	1.0e-171
WP_006014021.1|1393502_1394417_+	helix-turn-helix transcriptional regulator	NA	E9P5Z7	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	58.9	1.3e-84
WP_006014023.1|1394442_1395354_+	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR7	Wolbachia_phage	58.4	1.5e-85
WP_129827306.1|1395449_1396364_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	77.9	1.5e-133
WP_006013123.1|1396309_1396876_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	94.7	4.6e-85
WP_096616077.1|1396964_1398053_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_129827307.1|1398068_1399031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014035.1|1399698_1400952_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_006014037.1|1400974_1401493_-	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	34.4	1.4e-11
WP_006014039.1|1401505_1403407_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.9	9.9e-132
WP_006014041.1|1403403_1403586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039950622.1|1403592_1404075_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_006014044.1|1404266_1405595_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_006014046.1|1405898_1406909_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	29.0	3.0e-18
WP_096676677.1|1407685_1408558_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006014054.1|1409123_1410104_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_006014056.1|1410109_1410703_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.5	1.1e-25
WP_006014058.1|1410710_1411496_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_125855783.1|1412034_1412400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012481935.1|1412384_1412660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014063.1|1412797_1413835_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	2.1e-59
WP_096641516.1|1413831_1414554_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	38.5	9.2e-38
WP_006014067.1|1414628_1415327_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_006014069.1|1415323_1415701_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_006014071.1|1415954_1417205_+	DUF3333 domain-containing protein	NA	NA	NA	NA	NA
WP_006014073.1|1417201_1417999_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	A9YX36	Burkholderia_phage	32.0	1.2e-22
WP_096616077.1|1418068_1419157_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
WP_006014087.1|1419315_1419909_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_006014085.1|1419924_1420740_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	34.5	1.1e-28
WP_039950626.1|1420757_1420985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129827232.1|1421452_1422325_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_096676677.1|1423511_1424384_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_039950628.1|1424423_1424975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006014095.1|1425366_1426386_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_129827318.1|1426673_1426775_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_129827234.1|1427748_1429020_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096616077.1|1429999_1431088_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	81.2	1.1e-172
>prophage 16
NZ_CP041924	Wolbachia pipientis strain wAlbB-HN2016 chromosome, complete genome	1483853	1439082	1447974	1483853		Wolbachia_phage(100.0%)	7	NA	NA
WP_006013990.1|1439082_1440069_-	helix-turn-helix transcriptional regulator	NA	A0A1B2LRR7	Wolbachia_phage	97.0	1.1e-174
WP_006013992.1|1440115_1441024_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRS2	Wolbachia_phage	97.0	3.2e-157
WP_129827233.1|1441141_1442413_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_051008237.1|1442985_1444113_-	hypothetical protein	NA	A0A1B2LRQ6	Wolbachia_phage	93.1	4.9e-179
WP_006014130.1|1444343_1445009_-	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	99.1	4.8e-118
WP_006014132.1|1445179_1446118_-	helix-turn-helix domain-containing protein	NA	A0A1B2LRR8	Wolbachia_phage	99.7	4.1e-163
WP_006014134.1|1446186_1447974_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	99.2	0.0e+00
