The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	443650	532256	1950487	capsid,holin,terminase,integrase,transposase,portal,tail,tRNA,protease,head	Lactobacillus_phage(32.0%)	96	450293:450316	532362:532385
WP_065825252.1|443650_444580_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	33.3	1.8e-25
WP_096585790.1|445307_447305_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	41.7	3.1e-19
WP_096584412.1|447638_450062_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.9	0.0e+00
450293:450316	attL	AAAAGCACGTTTCAAAAAAGAGTG	NA	NA	NA	NA
WP_011375127.1|450661_452014_+	amino acid permease	NA	NA	NA	NA	NA
WP_011375126.1|452271_452646_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011375125.1|452795_453974_+	MFS transporter	NA	NA	NA	NA	NA
WP_011375124.1|454521_456159_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011375123.1|456155_456875_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011375122.1|456902_457736_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_096584415.1|458092_459205_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	41.6	2.4e-69
WP_148664861.1|459383_460268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096584421.1|460435_461056_-	LexA family transcriptional regulator	NA	A0A1B2APZ3	Phage_Wrath	65.1	3.1e-42
WP_096585791.1|461214_461445_+	helix-turn-helix transcriptional regulator	NA	E9LUS9	Lactobacillus_phage	56.6	2.0e-15
WP_096584424.1|461461_462238_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	54.3	7.2e-73
WP_096584427.1|462269_462581_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_096584430.1|462814_463015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584433.1|463108_463300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584436.1|463299_463644_+	siphovirus Gp157 family protein	NA	A0A2H4JBT9	uncultured_Caudovirales_phage	48.6	1.5e-06
WP_172425578.1|463601_463784_+	siphovirus Gp157 family protein	NA	NA	NA	NA	NA
WP_096584442.1|463774_465154_+	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	63.1	8.7e-162
WP_096584445.1|465150_465876_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	60.3	1.0e-65
WP_056966820.1|465878_466391_+	hypothetical protein	NA	A0A0A1ELK1	Lactobacillus_phage	35.4	1.2e-23
WP_096584448.1|466462_467305_+	bifunctional DNA primase/polymerase	NA	A0A1B0Y4T1	Lactobacillus_phage	60.3	8.4e-83
WP_096584451.1|467252_468488_+	helicase	NA	A0A1B0Y896	Lactobacillus_phage	56.4	1.6e-130
WP_096584453.1|468782_469103_+	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	71.7	6.9e-38
WP_096584455.1|469108_469297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584457.1|469293_470001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584459.1|470020_470416_+	hypothetical protein	NA	C9E2N9	Enterococcus_phage	39.0	2.3e-06
WP_096584461.1|470420_470609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172425579.1|470651_470801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172425566.1|470866_471142_+	hypothetical protein	NA	Q9AZZ8	Lactococcus_phage	50.0	1.9e-07
WP_096584463.1|471252_471450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584465.1|471463_471646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584467.1|471924_472272_+	DUF1642 domain-containing protein	NA	C1KFT5	Lactobacillus_virus	47.4	9.2e-20
WP_172425580.1|472268_472418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584469.1|472401_472770_+	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	36.1	1.3e-11
WP_096584471.1|472918_473170_+	hypothetical protein	NA	A0A291I9M4	Lactobacillus_phage	59.0	4.8e-18
WP_172425581.1|473169_473328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056948437.1|473308_473722_+	hypothetical protein	NA	E9LUP5	Lactobacillus_phage	40.0	2.9e-20
WP_096584475.1|474026_474389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099769415.1|474442_475511_+|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
WP_096584477.1|475682_476138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584479.1|476524_476932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584481.1|476935_477187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584483.1|477273_477639_+	HNH endonuclease	NA	A0A0M4RCH0	Enterococcus_phage	40.9	2.3e-21
WP_096584485.1|477762_478224_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	44.4	2.8e-24
WP_096584487.1|478216_479926_+|terminase	terminase large subunit	terminase	A0A249XUH4	Enterococcus_phage	39.8	3.0e-119
WP_172425582.1|479937_480102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584489.1|480106_481297_+|portal	phage portal protein	portal	A0A2H4JA65	uncultured_Caudovirales_phage	35.2	1.8e-59
WP_096585793.1|481277_481820_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0M4R4P2	Enterococcus_phage	48.6	6.2e-39
WP_096584491.1|481855_482980_+|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	42.8	4.9e-70
WP_096584493.1|483012_483231_+	Ig domain-containing protein	NA	A0A1D6Z291	Staphylococcus_phage	55.6	1.7e-08
WP_096584495.1|483244_483574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	33.7	1.3e-07
WP_172425583.1|483566_483866_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_096584501.1|483862_484219_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	35.6	3.5e-14
WP_096584503.1|484211_484634_+	hypothetical protein	NA	E9LUI8	Lactobacillus_phage	38.9	1.5e-19
WP_096584506.1|484620_485205_+|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	49.5	5.7e-46
WP_096584509.1|485275_485578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172425584.1|485628_485781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584512.1|485796_490116_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	51.8	3.0e-200
WP_085845083.1|490108_490822_+	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	37.2	1.0e-41
WP_096584516.1|490821_492336_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	33.8	1.0e-62
WP_096584520.1|492335_493991_+	hypothetical protein	NA	G2J5Q9	Lactobacillus_virus	32.9	3.2e-25
WP_096585794.1|494118_494385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584523.1|494381_494591_+|holin	holin	holin	A0A2H4IZQ3	uncultured_Caudovirales_phage	47.5	1.3e-05
WP_096584526.1|494587_495499_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	63.0	2.2e-57
WP_096584529.1|495761_496208_+	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	40.1	2.0e-22
WP_096584532.1|496208_496598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584535.1|496639_496894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011375121.1|497236_497437_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_096584538.1|497467_499708_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	3.9e-95
WP_096584541.1|499835_500624_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_096584544.1|500577_501516_-	alpha/beta hydrolase	NA	O11456	Ectromelia_virus	26.3	8.3e-15
WP_096584547.1|501697_503290_-	APC family permease	NA	NA	NA	NA	NA
WP_011375116.1|503644_503851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096584550.1|504302_506243_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	41.2	2.6e-34
WP_056948128.1|506506_508198_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.5	3.9e-79
WP_056948130.1|508588_509350_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_056947380.1|509478_509865_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056947382.1|509854_510742_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	4.2e-08
WP_096584553.1|510759_511917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011375108.1|512092_513526_-	amino acid permease	NA	NA	NA	NA	NA
WP_172425605.1|513699_515259_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_011375106.1|515338_515575_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_011375105.1|515687_516446_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_096584560.1|516461_518816_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.0	4.7e-91
WP_025016036.1|518824_519295_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.3	2.0e-46
WP_096584563.1|520780_521671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076632110.1|522139_522631_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_096584566.1|522753_525414_+	DNA polymerase I	NA	B6V2J7	Bacillus_phage	32.4	5.2e-46
WP_056947267.1|525425_526262_+	DNA-formamidopyrimidine glycosylase	NA	F8WPX6	Bacillus_phage	32.3	9.0e-29
WP_076632108.1|526261_526870_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_016265454.1|527177_527651_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_011375095.1|527668_529048_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_011375094.1|529047_529974_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	38.7	3.8e-28
WP_011375093.1|530285_532256_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	34.0	3.8e-102
532362:532385	attR	AAAAGCACGTTTCAAAAAAGAGTG	NA	NA	NA	NA
>prophage 2
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	634854	642919	1950487		Bacillus_phage(33.33%)	9	NA	NA
WP_011374977.1|634854_635181_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	34.6	5.4e-06
WP_011374976.1|635197_635563_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_096584663.1|635648_636641_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.7	7.9e-48
WP_096584666.1|636785_639098_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.1	3.8e-77
WP_096584669.1|639121_639640_+	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	32.2	5.6e-13
WP_011374972.1|639732_640347_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	58.2	1.1e-15
WP_016265356.1|640481_640724_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_011374970.1|640804_641035_+	YneF family protein	NA	NA	NA	NA	NA
WP_096584672.1|641176_642919_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	9.9e-46
>prophage 3
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	721755	760147	1950487	transposase	Enterococcus_phage(20.0%)	43	NA	NA
WP_011373852.1|721755_722676_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_056948747.1|722773_724252_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_096584763.1|724265_725915_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_025016360.1|725931_726420_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_096584766.1|726428_727229_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_011374894.1|727225_727834_+	SGNH/GDSL hydrolase family protein	NA	A0A0S2SXG8	Bacillus_phage	30.6	1.0e-13
WP_011374893.1|727889_728597_-	VIT family protein	NA	NA	NA	NA	NA
WP_011374892.1|728656_729337_-	VIT family protein	NA	NA	NA	NA	NA
WP_011374891.1|729511_730150_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011374890.1|730165_730585_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096584769.1|730603_731017_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011374888.1|731032_731353_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016265300.1|731656_732415_+	nicotinamide mononucleotide transporter	NA	C1KFI0	Lactobacillus_virus	61.4	2.4e-81
WP_096584772.1|732468_734304_-	pyruvate oxidase	NA	G9E525	Ostreococcus_lucimarinus_virus	24.8	8.9e-13
WP_025016364.1|734507_735266_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.0	2.0e-11
WP_011374884.1|735262_736126_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_011374883.1|736122_737124_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_056948736.1|737670_738930_+	cytochrome P450	NA	NA	NA	NA	NA
WP_082267781.1|739527_739764_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011374879.1|739767_740550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011374878.1|740492_740741_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011374877.1|740842_742189_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011374876.1|742304_742616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056948729.1|742637_743366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011374874.1|743387_743975_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_011374872.1|744385_744529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011374871.1|744786_745221_-	universal stress protein	NA	NA	NA	NA	NA
WP_096584775.1|745447_746140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076639187.1|746261_746936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016265287.1|747152_747872_+	aquaporin family protein	NA	M1HCP3	Acanthocystis_turfacea_Chlorella_virus	34.1	2.9e-28
WP_011374867.1|748222_749596_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.4	5.1e-45
WP_011374866.1|749647_750127_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	37.2	3.8e-16
WP_011374865.1|750259_750433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096584778.1|750590_752633_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.9	8.9e-70
WP_096584781.1|752874_753570_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	44.8	5.6e-16
WP_096584784.1|753596_753971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011374861.1|753990_754236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584787.1|754235_755540_+	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	39.9	1.6e-85
WP_148664864.1|755532_755778_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	40.7	2.6e-05
WP_099769415.1|755767_756836_+|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
WP_065825252.1|756900_757830_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	33.3	1.8e-25
WP_011374858.1|758485_758737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056948015.1|759451_760147_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	40.3	5.0e-17
>prophage 4
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	906498	914065	1950487	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_096584934.1|906498_907371_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.5	8.2e-57
WP_056947591.1|907518_908712_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	33.0	3.9e-33
WP_011374705.1|908780_909242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096584937.1|909354_911244_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	3.0e-48
WP_076647572.1|911561_912512_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	2.7e-122
WP_025015767.1|912522_913023_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.7	3.5e-28
WP_025015768.1|913219_914065_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	44.2	7.7e-20
>prophage 5
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	1277533	1327026	1950487	holin,transposase,bacteriocin,tRNA,protease	Anomala_cuprea_entomopoxvirus(12.5%)	51	NA	NA
WP_096585258.1|1277533_1278163_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_011374343.1|1278181_1278502_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011374342.1|1278623_1278950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011374341.1|1279021_1279663_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_096585261.1|1279830_1280661_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_041820776.1|1280793_1281993_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011374338.1|1281995_1282724_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.5e-19
WP_011374337.1|1282944_1283373_+	HIT family protein	NA	D7NW73	Streptomyces_phage	30.4	3.8e-07
WP_011374336.1|1283375_1283702_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_049762126.1|1283867_1284776_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011374334.1|1284836_1285805_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_056948285.1|1285794_1288506_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_076632396.1|1288508_1289702_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_056948281.1|1289836_1290181_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_056948279.1|1290204_1292286_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_096585807.1|1292488_1293331_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	5.4e-05
WP_096585264.1|1293446_1294106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172425607.1|1294102_1295035_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011374326.1|1295049_1295676_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035146539.1|1295690_1296842_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	32.7	5.1e-22
WP_056948275.1|1297113_1297581_-	arginine repressor	NA	NA	NA	NA	NA
WP_142501179.1|1297767_1300611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011374321.1|1300632_1300989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011374320.1|1300969_1301671_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_096585273.1|1301688_1302744_+	DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_011374316.1|1303419_1304715_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	69.7	2.2e-167
WP_011374315.1|1304832_1305588_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_096585276.1|1305613_1306828_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_056948271.1|1306928_1307942_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011374312.1|1307980_1309018_-	sugar-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096585279.1|1309445_1310120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056947469.1|1310288_1311695_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_011373852.1|1311982_1312903_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_011374291.1|1314637_1315063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016264798.1|1315040_1315631_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_096585281.1|1315652_1317128_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_011374288.1|1317235_1318108_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011374287.1|1318232_1318958_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_011374286.1|1318997_1319237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011374285.1|1319245_1319488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011374284.1|1319646_1320999_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096585284.1|1321155_1321593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096585288.1|1321579_1322212_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011374281.1|1322356_1323397_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	A0A1W6JHY1	Lactococcus_phage	33.8	5.1e-13
WP_076645002.1|1323566_1323851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035146515.1|1323934_1324258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056947916.1|1324330_1324567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056947920.1|1324799_1325087_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011374275.1|1325105_1325438_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_011374274.1|1325578_1325761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099769415.1|1325956_1327026_-|transposase	IS3-like element IS1520 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.9	6.3e-27
>prophage 6
NZ_AP017931	Lactobacillus sakei strain LK-145	1950487	1355769	1365388	1950487		Streptococcus_phage(33.33%)	9	NA	NA
WP_056948808.1|1355769_1356213_+	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	45.9	3.5e-16
WP_025016311.1|1356894_1357479_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.4	1.5e-51
WP_016264751.1|1357703_1358228_+	DsbA family protein	NA	NA	NA	NA	NA
WP_035146456.1|1358342_1358798_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011374236.1|1358889_1359834_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.0	2.3e-52
WP_016264749.1|1359836_1360871_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.8	9.0e-95
WP_011374234.1|1360867_1361752_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	31.0	8.4e-09
WP_016264747.1|1361877_1362414_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_096585341.1|1362535_1365388_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	2.3e-305
