The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018254	Calothrix sp. NIES-3974	5985875	1171023	1209920	5985875	tRNA,protease,integrase,transposase	Escherichia_phage(25.0%)	24	1168051:1168070	1212057:1212076
1168051:1168070	attL	TTTCTCACAAAACCCTAAAA	NA	NA	NA	NA
WP_096620690.1|1171023_1171683_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096620691.1|1171934_1172687_+	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_096620692.1|1172678_1174106_-	DNA cytosine methyltransferase	NA	M9UXR6	Escherichia_phage	28.2	2.3e-24
WP_096620693.1|1174354_1175356_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096620694.1|1175457_1175910_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096620695.1|1175980_1176265_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096620696.1|1176437_1176680_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_096620697.1|1176700_1177348_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_096620698.1|1177390_1178281_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096620699.1|1178525_1179098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157780647.1|1179866_1180304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096620702.1|1180504_1182589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096625918.1|1182668_1183460_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096620703.1|1183608_1184070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096620705.1|1185219_1191066_+	hypothetical protein	NA	G0YQI6	Erwinia_phage	42.4	9.5e-08
WP_096620706.1|1191474_1192653_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	61.0	8.3e-129
WP_096620707.1|1194123_1194453_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.6	8.8e-12
WP_096620708.1|1194609_1195668_-	polysaccharide pyruvyl transferase CsaB	NA	NA	NA	NA	NA
WP_096620709.1|1196020_1196950_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096620710.1|1197166_1197949_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_096620712.1|1203669_1204539_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_096620713.1|1204594_1205068_+	DUF4079 domain-containing protein	NA	NA	NA	NA	NA
WP_096620714.1|1205072_1207451_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_096620715.1|1208384_1209920_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1212057:1212076	attR	TTTCTCACAAAACCCTAAAA	NA	NA	NA	NA
