The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	9616	52537	7235916	transposase	Pseudomonas_phage(40.0%)	31	NA	NA
WP_096614156.1|9616_10441_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096614158.1|10437_10896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614161.1|11142_11820_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_096618325.1|11934_12369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611141.1|12479_13781_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096614163.1|14682_15840_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096614154.1|15973_16297_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	39.7	3.7e-07
WP_096613539.1|17944_19756_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.8	4.6e-94
WP_096614152.1|19748_21062_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096614150.1|21208_22117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618324.1|22269_22950_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_096614165.1|24575_26495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614167.1|26571_27006_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096613173.1|28370_29606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096609154.1|29640_29928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618326.1|30863_31118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614169.1|31594_33148_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	31.9	4.1e-67
WP_096614171.1|33195_33618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614173.1|34669_35578_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096614175.1|35580_37593_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096614177.1|37613_40544_+	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.2	6.5e-82
WP_096614179.1|40533_40851_+	M48 family peptidase	NA	NA	NA	NA	NA
WP_096618327.1|40876_41380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614181.1|41379_42228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096612537.1|43606_45094_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_096612700.1|47635_48766_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096614183.1|48917_50108_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_096614185.1|50367_50643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614187.1|50806_51325_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MWH1	Cellulophaga_phage	30.4	3.9e-06
WP_096614189.1|51324_51546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614191.1|51538_52537_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	783145	929722	7235916	integrase,tail,plate,transposase	Bacillus_phage(22.22%)	105	838370:838385	886264:886279
WP_096610164.1|783145_784288_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096614813.1|784305_784521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614814.1|784878_785616_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_096614815.1|785608_788137_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_096614816.1|788198_792788_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096614817.1|793069_793276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614818.1|793364_793556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614819.1|793516_793744_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_096614820.1|793820_794732_-	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_096614714.1|794775_796137_-	DUF1822 domain-containing protein	NA	NA	NA	NA	NA
WP_096614715.1|796139_797540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614821.1|800235_800448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614822.1|800719_802135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614823.1|802235_802604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614824.1|802618_802873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614825.1|803437_806905_+	caspase	NA	NA	NA	NA	NA
WP_096614826.1|807227_810632_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_096612537.1|810889_812377_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_096614827.1|812488_812785_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_096614828.1|812726_817358_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_096614829.1|817409_818423_+	caspase family protein	NA	NA	NA	NA	NA
WP_096614830.1|820040_821843_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_096614831.1|823729_824995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614832.1|826061_826733_+	hypothetical protein	NA	S5WII0	Leptospira_phage	39.8	5.8e-10
WP_096613183.1|826708_827779_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096614833.1|828091_828562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614834.1|828599_829433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096614835.1|829509_829965_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096618380.1|830094_830721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096614836.1|831000_831426_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_096614837.1|831810_832872_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096614838.1|832945_833173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614839.1|833203_833635_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_096614840.1|833747_836558_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_096614841.1|836565_836964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614842.1|837219_837759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614843.1|837785_838358_-	methyltransferase	NA	NA	NA	NA	NA
838370:838385	attL	CCTTTGTTTTAATTAT	NA	NA	NA	NA
WP_096614844.1|838567_839698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614845.1|839723_840689_+	DUF1822 domain-containing protein	NA	NA	NA	NA	NA
WP_096613173.1|841060_842296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096609659.1|842367_842619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614846.1|842659_845827_+	peptidase	NA	NA	NA	NA	NA
WP_096614847.1|846225_846831_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_096614848.1|847020_847533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096614849.1|849447_851193_+|tail	phage tail protein	tail	J9PVC2	Bacillus_phage	33.7	1.9e-41
WP_096614850.1|851329_851857_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096614851.1|851967_852699_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_096614852.1|852695_853607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614853.1|853603_854947_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_096614854.1|854988_857070_+	ATP-binding protein	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	33.3	3.4e-08
WP_096614855.1|857066_857324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614856.1|857320_859036_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_096614857.1|860906_862850_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_096614858.1|863148_863808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614859.1|863804_864176_+	LysM domain-containing protein	NA	NA	NA	NA	NA
WP_096614860.1|864168_865293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614861.1|865289_865826_+|plate	baseplate assembly protein	plate	J9PUM0	Bacillus_phage	35.3	6.9e-06
WP_096614862.1|865841_866198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614863.1|866285_866645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614864.1|866644_869230_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_096614865.1|869382_872721_+|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	28.3	6.4e-17
WP_096614866.1|872788_875032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614867.1|875083_876541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614868.1|876558_877464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614869.1|877770_878115_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096614870.1|878095_878482_-	addiction module toxin RelE	NA	NA	NA	NA	NA
WP_096614871.1|879107_880271_+|integrase	site-specific integrase	integrase	G9BWC1	Planktothrix_phage	35.5	1.6e-55
WP_096614872.1|880386_881112_-	oxidoreductase	NA	NA	NA	NA	NA
WP_096614873.1|881191_881800_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_096614874.1|882064_882694_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096614875.1|882826_884041_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096614876.1|885923_886271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614877.1|886369_886825_+	phosphatase	NA	NA	NA	NA	NA
886264:886279	attR	ATAATTAAAACAAAGG	NA	NA	NA	NA
WP_096614703.1|886885_887260_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_096614878.1|890559_890799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614879.1|891282_892071_+	vancomycin resistance protein	NA	NA	NA	NA	NA
WP_096614880.1|892063_893104_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_096618381.1|893372_894938_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_096614881.1|894918_895920_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_096618382.1|896086_897190_-	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_096614882.1|898735_899356_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_096614883.1|899834_901970_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	25.9	4.6e-45
WP_096614884.1|902403_902679_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_096614885.1|903055_904354_-	threonine synthase	NA	NA	NA	NA	NA
WP_096614886.1|904917_907095_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_096609602.1|907192_908419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096614887.1|908582_909368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614888.1|909959_910778_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_096614889.1|910780_911026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614890.1|911181_911379_+	DUF2949 domain-containing protein	NA	NA	NA	NA	NA
WP_096614891.1|911964_913101_+	homocitrate synthase	NA	NA	NA	NA	NA
WP_096614892.1|913084_913372_+	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_096614893.1|913368_913572_+	putative nitrogen fixation protein NifT	NA	NA	NA	NA	NA
WP_096614894.1|914084_914723_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_096614895.1|915015_915549_+	DUF4330 domain-containing protein	NA	NA	NA	NA	NA
WP_096614896.1|915917_918080_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	30.7	1.4e-20
WP_096618383.1|918097_918523_+	response regulator	NA	NA	NA	NA	NA
WP_096614897.1|918691_920965_+	PAS domain S-box protein	NA	Q6XLV6	Feldmannia_irregularis_virus	23.0	1.4e-12
WP_096614898.1|923022_923565_+	phycobiliprotein lyase	NA	NA	NA	NA	NA
WP_096614899.1|923601_924216_+	phycobiliprotein lyase	NA	NA	NA	NA	NA
WP_096614900.1|924409_925141_+	dihydrobiliverdin:ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_096614901.1|925190_925946_+	phycoerythrobilin:ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_096614902.1|925966_926770_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096614903.1|927593_928652_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096618384.1|928501_929722_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	2977863	2984920	7235916	capsid	Pseudomonas_phage(28.57%)	11	NA	NA
WP_096616739.1|2977863_2978307_-	DUF1320 domain-containing protein	NA	A0A0A1IX76	Pseudomonas_phage	37.8	3.4e-11
WP_096616741.1|2978510_2978735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616743.1|2978743_2979700_-|capsid	phage capsid protein	capsid	B5TA95	Burkholderia_phage	38.9	1.1e-54
WP_096618497.1|2979727_2980165_-	DUF2190 domain-containing protein	NA	A0A0S4L3C3	Pseudomonas_phage	45.0	3.9e-15
WP_096616745.1|2980173_2981343_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	38.1	9.0e-51
WP_096616747.1|2981377_2981593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616749.1|2981602_2982049_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	30.5	4.5e-11
WP_096616751.1|2982058_2982556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616753.1|2982555_2983380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096616755.1|2983369_2984146_-	hypothetical protein	NA	A0A2H4PAR7	Aphanizomenon_phage	34.5	1.5e-38
WP_096616757.1|2984152_2984920_-	hypothetical protein	NA	A0A2H5BK13	Erwinia_phage	46.9	2.4e-36
>prophage 4
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	4132392	4201295	7235916	protease,integrase,transposase	Bacillus_phage(28.57%)	59	4159807:4159822	4177541:4177556
WP_096618212.1|4132392_4133880_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_096618213.1|4135358_4135685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618214.1|4135873_4136302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618215.1|4136525_4137185_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_096618216.1|4137193_4137658_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_096618217.1|4137843_4138221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618218.1|4140124_4140271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618219.1|4140813_4141416_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_096618220.1|4142648_4142948_-	ferredoxin	NA	A0A222YX16	Synechococcus_phage	54.7	4.5e-23
WP_096618221.1|4143146_4143518_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_096618222.1|4143672_4143876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618223.1|4143882_4144680_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_096618224.1|4144690_4145008_-	nitrogenase stabilizing/protective protein	NA	NA	NA	NA	NA
WP_096618225.1|4145004_4145235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618226.1|4145234_4145711_-	DUF269 domain-containing protein	NA	NA	NA	NA	NA
WP_096618227.1|4145707_4146121_-	nitrogen fixation protein NifX	NA	NA	NA	NA	NA
WP_096618228.1|4146295_4147615_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifN	NA	NA	NA	NA	NA
WP_096618229.1|4147731_4149162_-	nitrogenase iron-molybdenum cofactor biosynthesis protein NifE	NA	NA	NA	NA	NA
WP_096618230.1|4149920_4151471_+	recombinase family protein	NA	A0A2P1N2W7	Gordonia_phage	22.9	4.6e-10
WP_096618231.1|4151928_4152423_-	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_096618232.1|4152883_4153183_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_096618233.1|4153644_4154154_+	fatty acid hydroxylase	NA	NA	NA	NA	NA
WP_096618234.1|4154398_4155451_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.3	2.3e-21
WP_096618235.1|4155506_4156715_-	chromate transporter	NA	NA	NA	NA	NA
WP_096618236.1|4156884_4157922_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_096618237.1|4158460_4159765_-	nitrogenase molybdenum-iron protein subunit beta	NA	NA	NA	NA	NA
4159807:4159822	attL	AGGATTTAGGAATTAT	NA	NA	NA	NA
WP_096618238.1|4160346_4161660_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_096618239.1|4161904_4163995_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.8	7.9e-66
WP_096618240.1|4165085_4165388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618569.1|4165579_4165978_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_096618570.1|4166061_4166343_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_096618241.1|4166475_4166967_+	DUF4174 domain-containing protein	NA	NA	NA	NA	NA
WP_096618242.1|4167758_4169681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618243.1|4169903_4170536_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_096618244.1|4172993_4173845_-	DUF1206 domain-containing protein	NA	NA	NA	NA	NA
WP_096618245.1|4174004_4174580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618246.1|4174704_4175724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614305.1|4177448_4178714_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
4177541:4177556	attR	AGGATTTAGGAATTAT	NA	NA	NA	NA
WP_096618247.1|4179121_4179574_-	peptidase M48 Ste24p	NA	NA	NA	NA	NA
WP_096618248.1|4179769_4180573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618249.1|4180610_4180856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618250.1|4181159_4181729_-	DUF3611 domain-containing protein	NA	NA	NA	NA	NA
WP_096618251.1|4182140_4182512_-	response regulator	NA	W8CYM9	Bacillus_phage	34.7	1.4e-10
WP_096618252.1|4182704_4184381_+	PAS domain S-box protein	NA	A0A1B0VMK3	Pseudomonas_phage	27.6	9.0e-12
WP_096618253.1|4184496_4184985_-	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_096618254.1|4185333_4187166_+	transcriptional regulator	NA	W8CYM9	Bacillus_phage	33.3	1.5e-28
WP_096618255.1|4187294_4188329_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_096618256.1|4188672_4189116_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_096618257.1|4189161_4189743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618258.1|4189787_4191137_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_096618259.1|4191133_4192141_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_096618260.1|4192173_4192986_-	potassium channel protein	NA	NA	NA	NA	NA
WP_096618261.1|4192994_4194278_-	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_096618262.1|4194636_4195020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618263.1|4194945_4196343_-	9-cis-epoxycarotenoid dioxygenase	NA	NA	NA	NA	NA
WP_096618264.1|4197292_4197982_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_096610996.1|4198129_4199053_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_096618265.1|4199113_4199728_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_096618266.1|4200470_4201295_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	4234792	4284106	7235916	transposase,terminase	Bacteriophage(33.33%)	48	NA	NA
WP_096618292.1|4234792_4235611_-|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_096618293.1|4235610_4235841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618294.1|4235824_4236088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611141.1|4236733_4238035_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096618295.1|4238418_4238817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618296.1|4239234_4239654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618297.1|4239777_4240197_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_096618571.1|4240193_4240472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618298.1|4240706_4241516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618299.1|4241938_4242148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096618300.1|4242413_4242677_-	hypothetical protein	NA	A0A1L2BWY6	Bacteriophage	45.1	1.5e-06
WP_096618301.1|4242883_4243474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618302.1|4243564_4244662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618303.1|4244875_4245100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618304.1|4245089_4245482_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_096618305.1|4245467_4246046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612048.1|4246039_4246540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096611667.1|4246793_4248329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096618306.1|4248427_4250137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614753.1|4250136_4251333_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_096614754.1|4251532_4253101_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_096618307.1|4253929_4254154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618308.1|4254244_4254427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618309.1|4254984_4255353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096618310.1|4255349_4258466_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_096618311.1|4259056_4259299_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096618312.1|4260780_4261287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613173.1|4261283_4262519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096609659.1|4262590_4262842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613169.1|4265672_4266185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613167.1|4266249_4266795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613165.1|4267231_4267786_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_096613163.1|4267908_4268772_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_096613161.1|4269212_4270277_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_096613583.1|4270476_4270941_+	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_096613159.1|4270948_4271782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613157.1|4271815_4272199_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_096613155.1|4272380_4272914_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096613153.1|4272958_4273450_+	ATP-binding protein	NA	A0A2H4JFX6	uncultured_Caudovirales_phage	54.3	4.0e-45
WP_096613151.1|4273649_4274102_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_096613149.1|4274106_4274574_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096613147.1|4275714_4276170_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096613145.1|4276298_4276778_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_096613143.1|4276859_4277492_+	Vat family streptogramin A O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.9	1.2e-22
WP_096613141.1|4277863_4279054_+	MFS transporter	NA	NA	NA	NA	NA
WP_096612700.1|4280578_4281709_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096613139.1|4281926_4282145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611667.1|4282570_4284106_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	4550257	4632338	7235916	tRNA,transposase,protease	Bacillus_phage(22.22%)	58	NA	NA
WP_096612791.1|4550257_4551277_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_096613549.1|4551535_4552399_+	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
WP_096612790.1|4552955_4554632_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_096612788.1|4554636_4555308_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_096612786.1|4555392_4556631_+	cytochrome P450	NA	NA	NA	NA	NA
WP_096612784.1|4556900_4558862_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096612782.1|4558982_4559699_-	pirin family protein	NA	NA	NA	NA	NA
WP_096612780.1|4559895_4561017_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_096613547.1|4561155_4561728_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_096612778.1|4561979_4562222_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_096612776.1|4562243_4564313_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.4	8.0e-26
WP_096612774.1|4564372_4566058_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_096612772.1|4566162_4566483_-	potassium transporter TrkA	NA	NA	NA	NA	NA
WP_096612770.1|4566972_4568085_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_096612768.1|4568109_4569648_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_096609621.1|4569746_4570907_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096612766.1|4570935_4571601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612764.1|4572419_4573112_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_096612762.1|4573112_4573979_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.6	5.4e-61
WP_096612760.1|4574053_4574959_+	sugar kinase	NA	NA	NA	NA	NA
WP_096612758.1|4575255_4576125_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_096612756.1|4576169_4577249_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_096612754.1|4577366_4578155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612752.1|4578484_4581013_-	mannose-1-phosphate guanylyltransferase	NA	I7I009	Enterobacteria_phage	28.2	5.2e-11
WP_096612750.1|4581472_4583119_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_096612748.1|4583324_4583516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612746.1|4583836_4585150_+	cytochrome P450	NA	I6XF76	Cotesia_sesamiae_Mombasa_bracovirus	24.4	4.3e-17
WP_096612744.1|4585327_4586254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612742.1|4586283_4587462_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_096612740.1|4587887_4588940_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_096612738.1|4588923_4589967_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_096612736.1|4590118_4592227_-	flavin-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_096612734.1|4592385_4592619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612732.1|4592637_4592826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612730.1|4593012_4594104_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_096612728.1|4594491_4595451_+	Red carotenoid-binding protein	NA	NA	NA	NA	NA
WP_096613545.1|4595591_4595921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612726.1|4596048_4597815_-|protease	subtilisin-like serine protease	protease	A0A2L0UZX3	Agrobacterium_phage	26.1	2.1e-06
WP_096612724.1|4599447_4599993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612722.1|4600024_4601158_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_096612720.1|4601396_4602485_-	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_096612718.1|4603131_4604652_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_096613543.1|4604772_4605348_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_096612716.1|4606037_4607303_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096612714.1|4607449_4608889_+	ATPase	NA	W8CYF6	Bacillus_phage	31.5	8.3e-22
WP_096612712.1|4608940_4609156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612710.1|4609736_4611659_+	serine/threonine protein kinase	NA	A0A075BSL8	Microcystis_phage	56.4	9.5e-74
WP_096612708.1|4611907_4612330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613541.1|4612702_4613995_-	GHKL domain-containing protein	NA	W8CYM9	Bacillus_phage	32.5	1.4e-15
WP_096612706.1|4613994_4616769_-	CHASE2 domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.8	1.7e-47
WP_096612704.1|4616894_4617908_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_096612702.1|4618099_4620700_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_096612700.1|4621271_4622402_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_096610164.1|4623331_4624474_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096612698.1|4624718_4626518_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_096612696.1|4626578_4628246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613183.1|4628434_4629505_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096613183.1|4631267_4632338_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_AP018280	Calothrix sp. NIES-4101 DNA, complete genome	7235916	5760241	5842576	7235916	tail,plate,transposase	Bacillus_phage(18.18%)	59	NA	NA
WP_096611103.1|5760241_5761763_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_096611101.1|5762212_5762464_+	acetyltransferase	NA	NA	NA	NA	NA
WP_096611099.1|5762722_5764138_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_096611097.1|5764279_5764888_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_096611095.1|5765236_5767600_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.6	2.7e-46
WP_096611093.1|5767655_5769044_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	37.2	4.5e-17
WP_096611091.1|5769201_5770206_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_096611089.1|5770330_5771215_-	peptidase M15	NA	NA	NA	NA	NA
WP_096611087.1|5771561_5773046_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_096611085.1|5773262_5774273_+	MoxR family ATPase	NA	H6WG28	Cyanophage	46.7	1.2e-83
WP_096613370.1|5774305_5775454_+	hypothetical protein	NA	A0A2I7SAP6	Vibrio_phage	27.9	8.0e-28
WP_096611083.1|5775900_5776920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611081.1|5777190_5779887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611079.1|5779927_5781055_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_096611077.1|5781183_5783931_+	carbonate dehydratase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.9	1.3e-68
WP_096611075.1|5785489_5786551_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096611073.1|5786659_5788213_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.4e-20
WP_096611071.1|5788209_5789208_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_096611069.1|5789405_5791019_+	hypothetical protein	NA	Q5GQG9	Synechococcus_phage	39.1	1.8e-09
WP_096611067.1|5791140_5791560_-	GFA family protein	NA	NA	NA	NA	NA
WP_096611065.1|5791596_5791968_-	DUF2834 domain-containing protein	NA	NA	NA	NA	NA
WP_096611063.1|5792075_5792930_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_096610996.1|5793148_5794072_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_096613368.1|5794256_5795048_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_096611061.1|5797081_5797945_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096611059.1|5798131_5799550_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_096611056.1|5799719_5800895_+	ABC transporter	NA	NA	NA	NA	NA
WP_096611054.1|5800942_5801665_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	75.6	9.7e-88
WP_096611052.1|5801708_5803145_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096611050.1|5803236_5804556_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096611048.1|5804608_5806372_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096611046.1|5806466_5808971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611044.1|5809062_5809458_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_096611042.1|5809619_5811581_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_096611040.1|5811663_5812170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611038.1|5812212_5814888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611036.1|5814891_5815416_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611034.1|5815473_5815680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611032.1|5815791_5816157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611030.1|5816176_5816500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611028.1|5816761_5817250_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611026.1|5817456_5817930_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611024.1|5818036_5818510_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611022.1|5818684_5820391_-|tail	phage tail sheath family protein	tail	A0A127AW39	Bacillus_phage	29.5	2.7e-19
WP_096611020.1|5821055_5822327_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_096611018.1|5822462_5822675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611016.1|5822671_5824690_+	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	31.4	1.4e-06
WP_096611014.1|5824728_5824938_+	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_096611012.1|5825129_5825810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613366.1|5828892_5829297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611010.1|5830472_5830874_+|plate	baseplate protein	plate	V5YTB2	Pseudomonas_phage	48.8	4.1e-11
WP_096613364.1|5830940_5833139_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_096611008.1|5833207_5834257_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611006.1|5834366_5835674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611004.1|5835857_5836952_+	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_096611002.1|5837038_5838439_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_096611000.1|5838483_5840721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096610998.1|5840804_5841605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096610996.1|5841652_5842576_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP018274	Calothrix sp. NIES-4101 plasmid plasmid1 DNA, complete genome	2974672	1393340	1475674	2974672	plate,tail,transposase	Bacillus_phage(18.18%)	59	NA	NA
WP_096610996.1|1393340_1394264_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_096610998.1|1394311_1395112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611000.1|1395195_1397433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611002.1|1397477_1398878_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_096611004.1|1398964_1400059_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_096611006.1|1400242_1401550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611008.1|1401659_1402709_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096613364.1|1402777_1404976_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_096611010.1|1405042_1405444_-|plate	baseplate protein	plate	V5YTB2	Pseudomonas_phage	48.8	4.1e-11
WP_096613366.1|1406619_1407024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611012.1|1410106_1410787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611014.1|1410978_1411188_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_096611016.1|1411226_1413245_-	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	31.4	1.4e-06
WP_096611018.1|1413241_1413454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611020.1|1413589_1414861_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_096611022.1|1415525_1417232_+|tail	phage tail sheath family protein	tail	A0A127AW39	Bacillus_phage	29.5	2.7e-19
WP_096611024.1|1417406_1417880_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611026.1|1417986_1418460_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611028.1|1418666_1419155_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611030.1|1419416_1419740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611032.1|1419759_1420125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611034.1|1420236_1420443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611036.1|1420500_1421025_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096611038.1|1421028_1423704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611040.1|1423746_1424253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096611042.1|1424335_1426297_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_096611044.1|1426458_1426854_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_096611046.1|1426945_1429450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611048.1|1429544_1431308_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096611050.1|1431360_1432680_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_096611052.1|1432771_1434208_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_096611054.1|1434251_1434974_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	75.6	9.7e-88
WP_096611056.1|1435021_1436197_-	ABC transporter	NA	NA	NA	NA	NA
WP_096611059.1|1436366_1437785_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_096611061.1|1437971_1438835_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096613368.1|1440868_1441660_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_096610996.1|1441844_1442768_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_096611063.1|1442986_1443841_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_096611065.1|1443948_1444320_+	DUF2834 domain-containing protein	NA	NA	NA	NA	NA
WP_096611067.1|1444356_1444776_+	GFA family protein	NA	NA	NA	NA	NA
WP_096611069.1|1444897_1446511_-	hypothetical protein	NA	Q5GQG9	Synechococcus_phage	39.1	1.8e-09
WP_096611071.1|1446708_1447707_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_096611073.1|1447703_1449257_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.4e-20
WP_096611075.1|1449365_1450427_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_096611077.1|1451985_1454733_-	carbonate dehydratase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.9	1.3e-68
WP_096611079.1|1454861_1455989_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096611081.1|1456029_1458726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096611083.1|1458996_1460016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613370.1|1460462_1461611_-	hypothetical protein	NA	A0A2I7SAP6	Vibrio_phage	27.9	8.0e-28
WP_096611085.1|1461643_1462654_-	MoxR family ATPase	NA	H6WG28	Cyanophage	46.7	1.2e-83
WP_096611087.1|1462870_1464355_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_096611089.1|1464701_1465586_+	peptidase M15	NA	NA	NA	NA	NA
WP_096611091.1|1465710_1466715_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_096611093.1|1466872_1468261_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	37.2	4.5e-17
WP_096611095.1|1468316_1470680_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.6	2.7e-46
WP_096611097.1|1471028_1471637_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_096611099.1|1471778_1473194_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_096611101.1|1473452_1473704_-	acetyltransferase	NA	NA	NA	NA	NA
WP_096611103.1|1474153_1475674_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP018274	Calothrix sp. NIES-4101 plasmid plasmid1 DNA, complete genome	2974672	2528390	2614645	2974672	tRNA,protease,transposase	Alteromonas_phage(25.0%)	56	NA	NA
WP_096612609.1|2528390_2529797_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_096612611.1|2529886_2530111_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_096612613.1|2530266_2535399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612615.1|2535362_2536706_-	KAP family P-loop domain-containing protein	NA	NA	NA	NA	NA
WP_096612617.1|2537533_2537761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612619.1|2538149_2538932_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_096612621.1|2539013_2539325_-	DUF3067 domain-containing protein	NA	NA	NA	NA	NA
WP_096613533.1|2539620_2540160_+	cytochrome b6-f complex iron-sulfur subunit	NA	NA	NA	NA	NA
WP_096612623.1|2540196_2541198_+	apocytochrome f	NA	NA	NA	NA	NA
WP_096612625.1|2541327_2541960_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_096612627.1|2542747_2543737_-	DUF3641 domain-containing protein	NA	NA	NA	NA	NA
WP_096610164.1|2544228_2545371_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096612629.1|2546588_2547557_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_096612631.1|2548128_2548803_-	DNA-binding response regulator	NA	A0A1J0GWE0	Alteromonas_phage	27.4	4.3e-05
WP_096612633.1|2549341_2549629_-	nitrogenase	NA	NA	NA	NA	NA
WP_096612635.1|2549882_2551484_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_096612637.1|2551573_2553370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612639.1|2553444_2553945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612641.1|2554237_2554621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612643.1|2555253_2555883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612645.1|2555989_2556772_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_096612647.1|2556885_2558364_+	alpha-amylase	NA	NA	NA	NA	NA
WP_096612649.1|2558768_2559224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612651.1|2559220_2560180_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.0	1.4e-20
WP_096613535.1|2560724_2562326_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_096612653.1|2562353_2563517_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	35.1	3.9e-14
WP_096612655.1|2563720_2564128_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096612657.1|2564403_2565075_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_096612659.1|2565228_2566590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612661.1|2566993_2567479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096612663.1|2567671_2567983_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_096612665.1|2568340_2569786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613537.1|2569995_2571342_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_096612667.1|2571412_2572324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612669.1|2572701_2573874_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_096612671.1|2573947_2575027_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_096612673.1|2575269_2575800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612675.1|2576801_2579267_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096612677.1|2579415_2581053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612680.1|2581166_2581847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612682.1|2581905_2584284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612684.1|2584437_2586918_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096613173.1|2588191_2589427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096609659.1|2589498_2589750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612686.1|2589829_2591401_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096613539.1|2591512_2593324_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	39.8	4.6e-94
WP_096612688.1|2593985_2596484_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096612690.1|2596549_2599126_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096612692.1|2599232_2599436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612694.1|2599512_2601999_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096613183.1|2603578_2604649_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096613183.1|2606411_2607482_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096612696.1|2607670_2609338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096612698.1|2609398_2611198_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_096610164.1|2611442_2612585_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_096612700.1|2613514_2614645_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP018276	Calothrix sp. NIES-4101 plasmid plasmid3 DNA, complete genome	55090	0	17966	55090	integrase	Bacillus_phage(50.0%)	10	10462:10474	23267:23279
WP_096613777.1|983_5468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613779.1|5531_6554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613781.1|6602_7508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613783.1|7583_8213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613785.1|8224_9073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613787.1|9076_10066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613789.1|10151_12479_-	hypothetical protein	NA	NA	NA	NA	NA
10462:10474	attL	TTCAACTTTTTGG	NA	NA	NA	NA
WP_096613791.1|13145_14078_-|integrase	integrase	integrase	A0A0E3M2X0	Bacillus_phage	26.5	1.3e-15
WP_096613793.1|14861_15056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613795.1|16052_17966_+	DUF3991 domain-containing protein	NA	M1NXP9	Cellulophaga_phage	27.5	6.0e-12
23267:23279	attR	TTCAACTTTTTGG	NA	NA	NA	NA
>prophage 2
NZ_AP018276	Calothrix sp. NIES-4101 plasmid plasmid3 DNA, complete genome	55090	23638	29770	55090		Leptospira_phage(33.33%)	6	NA	NA
WP_096613805.1|23638_24661_-	chromosome partitioning protein ParB	NA	S5VTK0	Leptospira_phage	33.6	1.1e-09
WP_096613807.1|24657_25413_-	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	29.7	1.1e-17
WP_096613809.1|25616_25808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613811.1|25894_26341_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_096613813.1|26337_26577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613815.1|26830_29770_-	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.9	3.9e-103
>prophage 3
NZ_AP018276	Calothrix sp. NIES-4101 plasmid plasmid3 DNA, complete genome	55090	50431	51397	55090	integrase	Clostridioides_phage(100.0%)	1	39686:39697	52605:52616
39686:39697	attL	TAAAAATTTAAA	NA	NA	NA	NA
WP_096613838.1|50431_51397_+|integrase	integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	24.2	1.2e-13
WP_096613838.1|50431_51397_+|integrase	integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	24.2	1.2e-13
52605:52616	attR	TAAAAATTTAAA	NA	NA	NA	NA
>prophage 1
NZ_AP018277	Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome	126615	44475	108356	126615	protease,transposase,integrase	Virus_Rctr85(14.29%)	51	65882:65941	91803:92806
WP_096613902.1|44475_45432_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	42.6	6.4e-55
WP_096613904.1|45613_46000_-|protease	aspartyl protease	protease	NA	NA	NA	NA
WP_096613906.1|45990_46314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613999.1|46348_46885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613908.1|47074_47959_-	DUF4351 domain-containing protein	NA	NA	NA	NA	NA
WP_096614001.1|48468_50580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613910.1|50783_51485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613912.1|51713_52151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613914.1|52156_52450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613916.1|52667_52937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613918.1|52936_53185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613920.1|53554_53989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613922.1|54015_54963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613924.1|55291_55462_+	ParG	NA	NA	NA	NA	NA
WP_096613926.1|56739_60585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096614003.1|61226_61802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613928.1|61798_62446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613930.1|63559_63961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613932.1|64171_64567_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_096613934.1|65301_65907_+	hypothetical protein	NA	NA	NA	NA	NA
65882:65941	attL	TGAGGTACAGTAACAGCAATGAGTAAACCAATTACGAATTTCATTTAAAGAGACTTTATT	NA	NA	NA	NA
WP_096613936.1|67497_68355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613938.1|68795_69791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613940.1|70080_70395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613942.1|70851_71805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613944.1|71750_72353_-	ParA family protein	NA	A0A2P1A2G0	Mycobacterium_phage	30.5	6.8e-10
WP_096613946.1|72902_77114_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.3	1.1e-24
WP_096613948.1|77157_77418_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_096613950.1|77748_77934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613952.1|78906_81531_-	S-layer family protein	NA	NA	NA	NA	NA
WP_096614005.1|82260_82665_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041741238.1|83610_83835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613954.1|83831_84251_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_096613956.1|84655_85258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613958.1|85271_85511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613960.1|85507_85774_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	50.6	2.1e-16
WP_096613962.1|86444_87452_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096613964.1|87506_87935_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_096613966.1|87877_88189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613968.1|88467_88731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613970.1|89136_90210_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_096613972.1|90216_91383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613974.1|91796_92748_-|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	27.5	8.2e-18
WP_096613976.1|93955_94645_+	hypothetical protein	NA	NA	NA	NA	NA
91803:92806	attR	TGAGGTACAGTAACAGCAATGAGTAAACCAATTACGAATTTCATTTAAAGAGACTTTATTAAAAGCTATTTCAATAGCTTGTGCCAAATCTGGGTAAGTTCGGGCACCAATAGAACGTAGTGTCTCTTTAATTTTTGACCAGCAATTTTCAATTGGTGAAAACTCAGGAGAGTATGGTGGTAAATAAATTAATATAGCTCCTGCATCTTCAATCAATTTCTCAATATCTTTACCTAGATGAATAGAGCAATTATCCATAACAACACAAGCACCCTTCCAAAGTTTTGGGACTAATTTTTGAGAAATAAAAGCTTCAAATGTTAATCCATCAGTTGCACCCAAAATACTATATTGAGCAATGAGACCTCTCATACCTATTGCACCAATTAAAGAAACATTTTTGCTACGTTTATGGGGACGTTTACTATACGCCCTTTTTCCTTTACGGGCACGAGCATTTTTTCTTATTAAAGACAAATTAACACCTGCTTCATCAATAAATATAAGGTTTTCAGGCAAAATGGCTTGAATTCTTAACCAAAACTCTACTCTTAACTTCTGAACTCTTTCAGTTTCTTTTTCCGAAGCGTGCAATGTTTTTTTTTACCGTGATGCCTATCTTCTTTAACATTCTATCGACTGTTGAGCGACCGATAAGAACACCTGTTTTTTGTTCTAAAGAAATACGAATTTCTGCCAACGTAGCATCATTATTTGCTTCTACAATTTCTTCAAGAATTTTTAATTGCTGTTCGTTTAATTTCGGTGGAGTTTGCTCTTCCCTCACTTTCGGAGCAATATTTCCTGTTTCTCGATATTGTTTGAGTATTTTTTGAACAAAGCTTAAAGCAACTTTAAATCGAGTTGCAAGCTCGCGTTGTGATATTTTATCTTCGAGATAGGTATCAACTATCTTCTGGCGTAAGTCAATTGAGTATGGTTTCATTTAGAATTTTTACCAGATGCACTACCTGATTAAATATCGTACCTCATCAGACTGAGAA	NA	NA	NA	NA
WP_096613979.1|95112_95952_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_096613981.1|98549_98858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096613983.1|99203_99395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096613183.1|99570_100641_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_096613985.1|100940_102266_-	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	36.4	3.1e-15
WP_096613987.1|102262_104506_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	32.8	1.5e-46
WP_096613989.1|104502_105459_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096613183.1|107285_108356_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
