The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018203	Leptolyngbya boryana NIES-2135 DNA, complete genome	6255463	2161778	2170265	6255463		Bacillus_virus(16.67%)	10	NA	NA
WP_017286735.1|2161778_2163047_-	exonuclease subunit SbcD	NA	G3MA97	Bacillus_virus	28.0	7.8e-32
WP_017286736.1|2163052_2163853_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.5	3.4e-09
WP_017286737.1|2163884_2164139_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_017286738.1|2164169_2165675_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017286739.1|2165931_2166372_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.8	1.6e-16
WP_017286740.1|2166368_2167055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017286741.1|2167014_2167272_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.1	2.8e-21
WP_017286742.1|2167302_2168346_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.5	3.2e-23
WP_017286743.1|2168366_2168591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017286744.1|2168669_2170265_-	Hsp70 family protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	25.2	1.0e-17
>prophage 1
NZ_AP018205	Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome	553673	131974	291391	553673	transposase,integrase	Tupanvirus(25.81%)	89	286431:286456	293433:293458
WP_026148520.1|131974_132886_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017291618.1|132974_133490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291619.1|133482_134337_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	24.7	4.8e-09
WP_017291620.1|135034_136240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291621.1|136287_136509_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017291622.1|136832_138023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291623.1|137991_138819_-	ParA family protein	NA	NA	NA	NA	NA
WP_017291624.1|139177_139585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291625.1|139767_140670_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	39.0	1.4e-06
WP_017291626.1|140666_141365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291627.1|142648_142846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291628.1|142898_143360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291629.1|143350_144001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291630.1|143993_144593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291631.1|144861_145326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096735604.1|145440_146570_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.6	1.3e-25
WP_017291634.1|146587_147412_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081614819.1|147587_148607_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017291636.1|148579_150364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291637.1|150405_150588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291638.1|150577_152647_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_017291639.1|152783_153179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291640.1|153501_153825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291641.1|153947_154517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291642.1|154538_154829_+	hypothetical protein	NA	A0A2H4PAR5	Aphanizomenon_phage	32.2	6.8e-08
WP_017291643.1|155025_156072_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_017291646.1|157826_158720_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_017286974.1|158898_160098_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_081614820.1|159941_162389_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	1.2e-28
WP_017291649.1|162453_166188_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.9	5.6e-30
WP_017291650.1|166254_172275_+	AAA family ATPase	NA	W8CYF6	Bacillus_phage	32.6	1.4e-25
WP_017291651.1|172312_175885_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.9	3.1e-25
WP_086371085.1|177498_178554_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086371084.1|178672_180136_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	6.4e-22
WP_017291656.1|180122_181169_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086371083.1|181180_182149_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086371082.1|182172_183147_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	A0A076FFT9	Aureococcus_anophage	26.4	6.9e-12
WP_096735605.1|183265_188629_+	AAA family ATPase	NA	A0A0G2YB36	Acanthamoeba_polyphaga_mimivirus	26.6	2.9e-11
WP_086371080.1|189095_189935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291662.1|190796_192959_-	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	22.4	3.2e-09
WP_086371079.1|193269_193374_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086371078.1|193377_194724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291667.1|194711_195260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291668.1|195347_199070_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.5	4.2e-25
WP_017291669.1|199124_202376_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.3	3.4e-23
WP_017291670.1|202430_205298_-	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	29.3	1.8e-20
WP_086371077.1|205287_207657_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	3.3e-28
WP_017291674.1|207686_207866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291675.1|208185_208518_+	response regulator	NA	NA	NA	NA	NA
WP_017291676.1|208549_209449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017291677.1|210993_212283_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	3.2e-33
WP_017291678.1|212305_212611_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017291681.1|214443_215208_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017291682.1|215483_215918_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	31.6	8.0e-13
WP_017291683.1|216124_218050_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.6	8.2e-09
WP_017291684.1|218195_218465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291687.1|221479_222283_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_017291688.1|222279_222927_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.8	3.4e-07
WP_017291689.1|223191_224211_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_017291690.1|224207_225239_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_051077907.1|225331_225613_-	DUF1636 domain-containing protein	NA	NA	NA	NA	NA
WP_017291691.1|225940_226471_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_071596259.1|227196_228240_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017291693.1|228257_229217_+	sucrase ferredoxin	NA	NA	NA	NA	NA
WP_017291694.1|229228_230536_-	MFS transporter	NA	NA	NA	NA	NA
WP_017291695.1|231019_236284_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	24.4	9.8e-105
WP_017291696.1|236288_241076_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	41.8	3.7e-58
WP_017291697.1|241121_245888_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.7	5.8e-72
WP_017291698.1|245894_253718_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.1	6.8e-203
WP_017291699.1|253714_259201_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.2	5.9e-76
WP_017291700.1|259208_260270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017291701.1|260280_263550_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.3	3.5e-84
WP_017291702.1|263542_269236_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.9	2.4e-117
WP_017291703.1|269219_273200_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.1	2.6e-89
WP_017291704.1|273221_273977_+	thioesterase	NA	NA	NA	NA	NA
WP_017291705.1|274011_276153_+	acylase	NA	NA	NA	NA	NA
WP_017291706.1|276348_278940_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017291708.1|279091_279316_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_026149073.1|279611_281258_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_017291710.1|281495_282257_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	44.6	2.3e-47
WP_017291711.1|282272_283823_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	41.3	3.7e-100
WP_017291712.1|283993_284725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291713.1|284993_285239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026149075.1|285407_286100_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	33.0	7.5e-21
286431:286456	attL	TGTACTGCAACGTTGCGGTACAGAAG	NA	NA	NA	NA
WP_017291715.1|286488_287733_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017291716.1|287756_288479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291717.1|288501_289107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017291718.1|289350_290151_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_017291719.1|290344_291391_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
293433:293458	attR	CTTCTGTACCGCAACGTTGCAGTACA	NA	NA	NA	NA
