The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	4185	76353	2148476	bacteriocin,transposase,integrase,protease,tRNA	Streptococcus_phage(33.33%)	57	NA	NA
WP_000163928.1|4185_4755_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258082.1|4755_8271_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|8328_8595_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|8587_8956_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224760.1|9075_10344_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001209050.1|10340_11618_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7K9Y8	Acanthocystis_turfacea_chlorella_virus	24.1	2.5e-06
WP_000892187.1|11621_12164_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.9	3.6e-10
WP_050209888.1|12179_14138_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	45.8	3.2e-109
WP_000588897.1|14259_14739_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000939548.1|22177_22414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|22644_23931_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
WP_000291875.1|24131_24599_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_096376093.1|24938_26195_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	91.4	6.8e-222
WP_000266841.1|26263_27406_-|integrase	site-specific integrase	integrase	U4KJ82	Streptococcus_phage	99.5	1.7e-211
WP_000401841.1|27460_28531_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	97.8	2.9e-181
WP_000285962.1|28936_29200_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	100.0	1.2e-43
WP_000156419.1|29199_29433_-	hypothetical protein	NA	A0A1S5S8D5	Streptococcus_phage	96.1	8.9e-35
WP_000464160.1|29432_29801_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SBE7	Streptococcus_phage	100.0	1.4e-63
WP_000142893.1|30214_30454_-	hypothetical protein	NA	A0A141DZS0	Streptococcus_phage	100.0	4.7e-39
WP_001112859.1|30518_30710_+	DNA-binding protein	NA	A0A141DZR9	Streptococcus_phage	100.0	3.0e-28
WP_001247549.1|30732_30936_+	hypothetical protein	NA	A0A141E1R6	Streptococcus_phage	95.5	1.3e-29
WP_000024180.1|31090_31258_-	YjzC family protein	NA	NA	NA	NA	NA
WP_000701992.1|31926_32370_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
WP_001842035.1|32371_32887_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_074017595.1|32900_34262_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001809263.1|34334_34832_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001812525.1|34856_35066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001832141.1|35047_35671_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000010163.1|35815_36784_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	4.0e-44
WP_000492733.1|37325_37559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233180.1|37551_37668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033627087.1|37882_38233_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_002202064.1|38488_41122_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.1	3.8e-57
WP_000076487.1|41206_41644_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000009170.1|41873_42884_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_000366342.1|43032_44202_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000616172.1|44198_44969_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000717458.1|44965_45958_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_000136447.1|45963_46197_+	acyl carrier protein	NA	A0A2I7RIC8	Vibrio_phage	40.6	3.3e-05
WP_001093069.1|46735_46966_+|bacteriocin	bacteriocin-like peptide BlpU	bacteriocin	NA	NA	NA	NA
WP_000668297.1|49175_51329_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	3.0e-44
WP_000801609.1|51341_52691_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043302.1|52860_53568_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.0e-41
WP_000361219.1|53769_57495_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.8	1.6e-37
WP_000220636.1|57587_59030_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	4.4e-55
WP_096376094.1|59066_60089_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.6	8.1e-64
WP_000717501.1|60085_60631_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	9.7e-24
WP_000894018.1|60714_61224_+	VanZ family protein	NA	NA	NA	NA	NA
WP_000167076.1|61248_62796_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.3	9.1e-75
WP_000772190.1|62917_64180_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_001831830.1|64582_65071_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.2e-17
WP_000099014.1|65057_66131_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001842755.1|66153_68538_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000610745.1|68710_70009_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.5	6.5e-18
WP_000679957.1|70063_74002_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_001007207.1|74316_75033_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001155321.1|75399_76353_+|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.6e-34
>prophage 2
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	114033	144252	2148476	bacteriocin,transposase,tRNA	Planktothrix_phage(50.0%)	28	NA	NA
WP_073077611.1|114033_114327_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000723961.1|114381_116490_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_050201518.1|116486_117128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.5e-23
WP_050201517.1|117333_118110_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_050201515.1|119359_120739_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001189281.1|121027_121348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012291603.1|122486_122699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001855207.1|123178_123418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050103268.1|123574_124633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001849786.1|124947_125925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424415.1|126301_126676_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619749.1|126883_127786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424446.1|127841_128174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066705.1|128170_128899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770312.1|130031_130271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001810010.1|130255_130534_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	50.5	1.1e-20
WP_096376096.1|130822_132685_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_001282967.1|133085_134207_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000220953.1|134812_136726_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331980.1|137078_138758_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639577.1|138759_138993_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000282487.1|139272_139488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974047.1|139810_139963_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180803.1|139964_140150_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
WP_000865708.1|140327_141011_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000569824.1|141007_141445_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000655043.1|141434_142445_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	NA	NA	NA	NA
WP_078063945.1|144171_144252_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	313919	360758	2148476	transposase,integrase,holin,protease	Streptococcus_phage(33.33%)	35	358672:358687	366001:366016
WP_001063366.1|313919_316025_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.6	2.0e-117
WP_000032550.1|316320_316803_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743630.1|316897_318382_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156819.1|318533_320141_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022221.1|320299_320473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664175.1|323118_323811_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	3.2e-64
WP_000684066.1|325379_326564_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	52.2	2.1e-103
WP_000287927.1|326579_327833_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000756065.1|328130_329051_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	5.9e-74
WP_001808869.1|329047_330265_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	86.2	1.5e-194
WP_024266168.1|330191_330749_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	45.4	2.4e-38
WP_096376102.1|332137_337441_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_050201457.1|337607_339767_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000248773.1|339763_340360_-	Holliday junction resolvase RecU	NA	A0A1L2JY30	Aeribacillus_phage	33.9	1.5e-17
WP_000179553.1|340426_340954_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000200644.1|341023_341365_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711398.1|341850_343008_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_050201456.1|343020_344415_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|344490_345915_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_000518018.1|345926_346616_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_050201455.1|346713_347679_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_050209859.1|347697_348696_+|holin	choline-binding protein CbpJ	holin	NA	NA	NA	NA
WP_050201453.1|348813_350046_-	MFS transporter	NA	NA	NA	NA	NA
WP_001831975.1|350088_350508_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000196971.1|351574_351904_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000163315.1|352025_352904_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373447.1|352885_353839_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_000562433.1|353825_354833_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210619.1|354816_355827_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224640.1|355904_356603_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743670.1|356599_357595_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698434.1|357608_358241_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075218746.1|358397_358709_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
358672:358687	attL	AAAACAGTGTTTTGAG	NA	NA	NA	NA
WP_000754502.1|359149_359389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000378125.1|360365_360758_+|integrase	tyrosine-type recombinase/integrase	integrase	C9E2L6	Enterococcus_phage	41.4	3.6e-20
366001:366016	attR	CTCAAAACACTGTTTT	NA	NA	NA	NA
>prophage 4
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	452053	499381	2148476	bacteriocin,tRNA	Klosneuvirus(20.0%)	48	NA	NA
WP_000181377.1|452053_452557_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185835.1|453009_453573_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002203629.1|453586_454213_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000867297.1|454240_454630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333646.1|454634_455084_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000418402.1|455211_455799_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_000105242.1|456188_457796_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.0	8.9e-142
WP_000026645.1|458354_459986_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000795219.1|460278_465219_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001096743.1|465308_466505_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119905.1|466640_467168_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659547.1|467244_467601_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_096376106.1|467637_468984_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_001808898.1|469073_469193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410533.1|469157_469307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220758.1|469758_471039_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	29.2	6.9e-12
WP_000651181.1|471095_471893_+	tyrosine-type DNA invertase PsrA	NA	A0A0H4TI16	Erysipelothrix_phage	28.7	1.7e-21
WP_061450986.1|471903_472509_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096376107.1|472456_474022_-	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	26.1	1.0e-12
WP_000029046.1|474021_475485_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000229101.1|475497_477831_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.6	5.8e-25
WP_001088687.1|478436_478946_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255766.1|479109_480144_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046031.1|480170_480695_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|481174_482998_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_001836078.1|483109_483364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001841444.1|483568_484705_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.8	5.3e-24
WP_001813906.1|485026_485266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777760.1|485427_485715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278301.1|485724_486135_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.6	3.4e-05
WP_000889923.1|486202_486934_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	9.0e-25
WP_000653771.1|486930_487980_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|488147_488477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682118.1|488752_489091_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219145.1|489095_489833_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001017624.1|489846_491187_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358817.1|491228_491384_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_001069090.1|491440_492802_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_078138292.1|492812_494456_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.4	8.2e-42
WP_050201397.1|494382_494970_-	peptidase C39	NA	NA	NA	NA	NA
WP_001093259.1|495267_495465_+|bacteriocin	bacteriocin-like peptide BlpI	bacteriocin	NA	NA	NA	NA
WP_001093248.1|495931_496201_+|bacteriocin	bacteriocin-like peptide BlpJ	bacteriocin	NA	NA	NA	NA
WP_000379964.1|496269_496500_+|bacteriocin	bacteriocin-like peptide BlpU	bacteriocin	NA	NA	NA	NA
WP_000346298.1|496502_496622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727118.1|496918_497083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846943.1|497079_497484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379880.1|498640_498988_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001818346.1|499231_499381_+|bacteriocin	bacteriocin-like peptide BlpO	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	802868	863870	2148476	bacteriocin,transposase,integrase,protease,tRNA,holin	Streptococcus_phage(42.11%)	53	807237:807279	825822:825864
WP_001200084.1|802868_804083_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001076714.1|804219_805044_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001108634.1|805817_806984_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
807237:807279	attL	ATACTCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCA	NA	NA	NA	NA
WP_000627748.1|807491_808985_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	31.8	3.0e-27
WP_050209871.1|808997_809915_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000260605.1|810006_810243_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|810239_810653_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000444456.1|810770_811736_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.8e-33
WP_000756225.1|811769_812813_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000526350.1|812841_816192_+	DEAD/DEAH box helicase family protein	NA	A0A2H4P9W3	Gordonia_phage	24.8	1.4e-11
WP_001042996.1|816777_817248_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212052.1|817264_819538_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561514.1|819902_823004_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.8	2.3e-114
WP_000820852.1|823086_824094_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|824152_825658_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000749599.1|827420_828293_+	DUF4300 family protein	NA	NA	NA	NA	NA
825822:825864	attR	TGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTAT	NA	NA	NA	NA
WP_000422665.1|828925_829237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759790.1|829240_829957_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617843.1|830086_830902_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123623.1|830898_831804_-	permease	NA	NA	NA	NA	NA
WP_000359137.1|832189_834319_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778577.1|834305_834755_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|834813_835086_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000342996.1|835133_835298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173352.1|836056_836815_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.0e-26
WP_000489391.1|836816_838805_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_162837274.1|838846_839491_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153906.1|839462_840512_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.4	1.2e-33
WP_000661011.1|841218_842694_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000366717.1|843630_844491_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000088773.1|844487_845747_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764381.1|845746_846874_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969444.1|846870_847956_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.8	3.1e-90
WP_001246759.1|847965_848841_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	8.4e-78
WP_000593582.1|849021_849831_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602452.1|850102_850324_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000909451.1|850743_851049_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001842783.1|851100_851298_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001025704.1|851290_852199_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|852195_852657_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403199.1|852646_853534_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.7e-09
WP_000728276.1|853536_855420_+|holin	phosphorylcholine esterase CbpE	holin	Q332B9	Clostridium_botulinum_C_phage	22.9	1.2e-09
WP_001844793.1|855499_856630_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.1e-114
WP_000254680.1|856639_857902_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.3	3.3e-139
WP_000689709.1|857905_858703_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.6	2.7e-59
WP_000033362.1|858818_859457_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	68.1	9.8e-76
WP_000806706.1|859453_860344_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.4	1.4e-72
WP_000358228.1|860383_860701_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166870.1|860703_861573_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.4	3.8e-115
WP_001261449.1|861799_862318_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345256.1|862426_862564_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_000008691.1|862570_863005_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	40.0	4.6e-08
WP_000997239.1|863062_863870_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	976778	1037205	2148476	transposase,integrase,protease	Streptococcus_phage(38.46%)	47	969885:969916	1035884:1035915
969885:969916	attL	CTCTTTGTCAACTGTAGTGGGTTGAAAAAAAG	NA	NA	NA	NA
WP_096376118.1|976778_977582_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000992855.1|977774_980066_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	9.5e-129
WP_000286922.1|980108_980789_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000743316.1|980785_981475_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_000653403.1|981492_982134_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_000462488.1|982216_982432_-	DUF4649 family protein	NA	NA	NA	NA	NA
WP_000863509.1|982439_982787_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_000639662.1|982791_983907_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	36.8	1.0e-27
WP_050201357.1|983916_984876_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	32.8	1.2e-37
WP_000681293.1|984988_985558_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_000171676.1|985685_986357_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_000799053.1|986340_987159_+	NAD kinase	NA	NA	NA	NA	NA
WP_001210010.1|987155_988052_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000451584.1|988095_989070_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000981522.1|990816_991116_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_078136756.1|991585_992185_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_001155321.1|992448_993402_+|transposase	IS30-like element ISSpn8 family transposase	transposase	H7BWC8	unidentified_phage	35.2	1.6e-34
WP_000109138.1|993649_993964_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000613699.1|993979_994324_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000916509.1|994340_994634_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000123635.1|994945_995152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587444.1|995589_996507_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_096376119.1|996599_997448_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	46.1	3.9e-64
WP_000161400.1|997589_998429_+	DegV family protein	NA	NA	NA	NA	NA
WP_001284639.1|998535_998811_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.3	9.2e-23
WP_050201511.1|999237_1001139_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	6.6e-51
WP_000400550.1|1001141_1002005_+	MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001083024.1|1002084_1003263_+	MFS transporter	NA	NA	NA	NA	NA
WP_001042590.1|1003355_1005314_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	35.9	1.2e-100
WP_000283047.1|1005425_1007705_+	type I pullulanase	NA	NA	NA	NA	NA
WP_000199371.1|1008249_1009674_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000370241.1|1010156_1012085_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_000787276.1|1012074_1013217_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_000687072.1|1013206_1014346_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_000697294.1|1014342_1015776_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_001818460.1|1015834_1016176_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_162499038.1|1016246_1016480_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000706412.1|1016488_1017604_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.2	1.9e-74
WP_000131076.1|1017600_1018047_-	YueI family protein	NA	NA	NA	NA	NA
WP_000022815.1|1018210_1019515_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	94.2	8.1e-234
WP_044811956.1|1019652_1020099_-|integrase	tyrosine-type recombinase/integrase	integrase	W6LMU7	Streptococcus_phage	75.5	5.0e-42
WP_000772347.1|1021249_1024525_+	ATP-dependent nuclease subunit B	NA	NA	NA	NA	NA
WP_000767210.1|1024521_1028172_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.1	8.8e-20
WP_000174774.1|1028341_1029520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417130.1|1029735_1035627_+|protease	immunoglobulin A1 protease	protease	NA	NA	NA	NA
WP_088800136.1|1035723_1035855_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000436628.1|1035948_1037205_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	92.1	4.3e-224
1035884:1035915	attR	CTCTTTGTCAACTGTAGTGGGTTGAAAAAAAG	NA	NA	NA	NA
>prophage 7
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	1060377	1087208	2148476	transposase	Streptococcus_phage(88.0%)	29	NA	NA
WP_049546323.1|1060377_1060593_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	98.5	9.4e-31
WP_000857133.1|1061053_1061284_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|1061280_1061703_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001240982.1|1062502_1065421_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
WP_000576156.1|1065424_1065979_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
WP_001038790.1|1066333_1067071_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
WP_001865637.1|1067195_1067279_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001860868.1|1067709_1067901_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	69.4	5.4e-14
WP_000873143.1|1068422_1068593_+	hypothetical protein	NA	A0A1X9I6E4	Streptococcus_phage	98.2	3.7e-22
WP_000417519.1|1068978_1070196_+	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	90.6	5.1e-198
WP_000420313.1|1070315_1071779_+	ABC-F type ribosomal protection protein Msr(D)	NA	A0A1B0RXA0	Streptococcus_phage	97.3	3.7e-251
WP_001072467.1|1071896_1072196_-	hypothetical protein	NA	A0A1B0RX98	Streptococcus_phage	96.0	1.8e-48
WP_000567222.1|1072182_1072551_-	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	97.5	1.1e-58
WP_000806926.1|1072563_1072899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001813542.1|1072895_1073141_-	hypothetical protein	NA	A0A1B0RXA7	Streptococcus_phage	98.8	2.6e-37
WP_000691745.1|1073504_1075424_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
WP_001791010.1|1075439_1075556_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224318.1|1075800_1076733_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
WP_000769868.1|1076729_1077731_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_096376120.1|1077727_1079905_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	88.6	0.0e+00
WP_000331160.1|1079907_1082355_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|1082338_1082845_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|1082819_1083317_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_096376121.1|1083433_1083655_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	98.6	2.8e-30
WP_000398284.1|1083697_1084903_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|1084925_1085078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016398735.1|1085080_1086463_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	99.8	7.9e-264
WP_000985015.1|1086491_1086878_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|1086893_1087208_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
>prophage 8
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	1220834	1278374	2148476	transposase,holin,protease	Bacillus_phage(33.33%)	52	NA	NA
WP_000411215.1|1220834_1221704_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609885.1|1221720_1222743_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638502.1|1222747_1223455_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835918.1|1223790_1225278_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811876.1|1225287_1226091_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	27.1	6.9e-10
WP_001199653.1|1226092_1226902_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
WP_001818492.1|1227176_1230353_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|1230665_1231745_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293845.1|1231794_1232718_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	8.7e-25
WP_000850024.1|1232736_1233258_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000244451.1|1233468_1234098_-	endonuclease III	NA	NA	NA	NA	NA
WP_000773222.1|1234097_1234640_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_001861318.1|1235364_1236924_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	9.3e-11
WP_000895725.1|1236967_1237867_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219823.1|1237868_1238429_-	LemA family protein	NA	NA	NA	NA	NA
WP_000801941.1|1238522_1239236_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000863628.1|1241064_1242636_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402066.1|1242647_1242980_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_001813294.1|1243070_1243448_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003474.1|1243519_1244824_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.5	7.7e-27
WP_000023524.1|1244836_1245643_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_096376126.1|1245810_1246158_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237399.1|1246276_1246606_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.0	1.4e-09
WP_000712093.1|1246599_1246974_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362440.1|1246970_1247237_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162128.1|1247352_1247796_-	flavodoxin	NA	NA	NA	NA	NA
WP_000401770.1|1247899_1248835_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|1248888_1249173_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000028153.1|1249229_1249448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199550.1|1250642_1251989_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000711943.1|1252484_1252655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718654.1|1255123_1255261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000945311.1|1255393_1256713_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_050201558.1|1256715_1257456_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	9.2e-09
WP_078144162.1|1257470_1259078_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	6.0e-13
WP_096376127.1|1259074_1261015_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_000807141.1|1263834_1263972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044791540.1|1264172_1264760_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000840773.1|1264852_1264996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566543.1|1265008_1265389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078137013.1|1265381_1265705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096376128.1|1265963_1266137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196960.1|1266322_1266691_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_001287278.1|1266766_1267267_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000862486.1|1267516_1268776_-	TRZ/ATZ family protein	NA	NA	NA	NA	NA
WP_050201533.1|1269077_1270826_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.6e-49
WP_050201534.1|1270827_1272552_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	3.2e-44
WP_000818203.1|1272609_1273548_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000692432.1|1273842_1274712_-	homoserine kinase	NA	NA	NA	NA	NA
WP_000216382.1|1274713_1276000_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000782676.1|1276150_1276888_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000530076.1|1277117_1278374_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	97.1	1.7e-233
>prophage 9
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	1330559	1393458	2148476	transposase,holin,tRNA	Streptococcus_phage(17.39%)	60	NA	NA
WP_000190635.1|1330559_1330745_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_096376131.1|1330931_1332278_+|transposase	IS1380-like element ISSpn5 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	40.0	5.8e-78
WP_096376132.1|1332512_1333064_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058033.1|1333359_1334184_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.8e-74
WP_000283115.1|1334180_1335641_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.5	2.3e-104
WP_000797177.1|1335755_1336244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1336233_1336443_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	49.1	4.1e-07
WP_000773490.1|1336828_1337557_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001810463.1|1339788_1340100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169079.1|1340114_1341401_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.6e-40
WP_001262531.1|1342024_1342207_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078131890.1|1342216_1342570_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000217307.1|1342577_1343768_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	37.4	7.0e-43
WP_001811052.1|1344442_1344601_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_050201556.1|1345055_1346420_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	4.2e-15
WP_001141946.1|1346407_1347103_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000368975.1|1347102_1347687_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_000657833.1|1347697_1349419_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.1e-28
WP_000708376.1|1349402_1351157_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.3	3.1e-23
WP_000122904.1|1351316_1352309_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000065694.1|1354415_1355978_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	8.4e-20
WP_000936188.1|1356119_1356818_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071694.1|1356860_1357757_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1357765_1358701_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102216.1|1358697_1359423_-	proteinase	NA	NA	NA	NA	NA
WP_000290644.1|1359506_1360142_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	27.7	9.6e-07
WP_000972936.1|1360143_1360971_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000274937.1|1360992_1361133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930002.1|1361328_1362045_-	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	30.3	9.8e-24
WP_001272961.1|1362557_1363169_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855734.1|1363213_1363942_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272306.1|1363979_1364891_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.8	4.5e-90
WP_000926599.1|1364956_1365181_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|1365258_1366002_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|1366001_1366802_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1366959_1367316_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170351.1|1367309_1367840_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|1367839_1368334_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1368468_1368915_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097988.1|1368911_1369559_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689945.1|1369579_1370161_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1370161_1371037_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036789.1|1371188_1372568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175407.1|1372861_1373785_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915944.1|1373844_1374450_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	5.9e-54
WP_000673678.1|1374467_1375712_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	3.8e-55
WP_000371287.1|1375828_1376086_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_023396345.1|1376127_1378164_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038736.1|1378375_1379293_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_001099673.1|1380693_1381536_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.7e-51
WP_001855094.1|1381649_1383041_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001810453.1|1383275_1383653_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_000915893.1|1383867_1384845_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000850585.1|1384841_1385924_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	1.8e-37
WP_001040724.1|1387417_1388614_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.6	7.3e-32
WP_000348125.1|1389524_1390394_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_000248998.1|1390617_1391139_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_001842801.1|1391110_1392202_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_000935663.1|1392312_1392567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200312.1|1392924_1393458_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	1458576	1465330	2148476	protease	Streptococcus_phage(50.0%)	9	NA	NA
WP_050201372.1|1458576_1459545_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	98.4	3.1e-65
WP_050201373.1|1459578_1460490_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.0	5.8e-154
WP_001231095.1|1460486_1461464_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	99.4	4.4e-184
WP_000163031.1|1461460_1462351_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	1.1e-05
WP_001140412.1|1462402_1462783_-	RidA family protein	NA	NA	NA	NA	NA
WP_000422599.1|1462793_1463381_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000106346.1|1463389_1464622_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.0	4.2e-131
WP_000442275.1|1464653_1464824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162488.1|1464823_1465330_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	42.5	6.7e-27
>prophage 11
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	1760485	1767817	2148476		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_000167845.1|1760485_1761187_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	35.1	1.7e-33
WP_000777246.1|1761609_1762569_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193668.1|1762558_1763515_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764307.1|1763511_1764264_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	5.6e-14
WP_000858259.1|1764359_1765325_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|1765549_1765792_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_001222228.1|1765791_1766514_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_050201353.1|1766500_1767070_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	3.9e-15
WP_050201352.1|1767088_1767817_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	3.4e-08
>prophage 12
NZ_AP017971	Streptococcus pneumoniae strain KK0981	2148476	2126134	2134888	2148476		Streptococcus_phage(33.33%)	9	NA	NA
WP_000510412.1|2126134_2126974_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.1e-15
WP_000835710.1|2126958_2127786_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.1e-22
WP_000712136.1|2127782_2128328_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2128338_2129160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170215.1|2129201_2130485_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	8.4e-18
WP_000424275.1|2130481_2131732_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.3	3.5e-93
WP_000455903.1|2131890_2132259_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2132261_2133359_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|2133409_2134888_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
