The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018036	Mycobacterium tuberculosis strain HN-506	4413362	2931346	2969618	4413362	protease,terminase,tRNA,integrase,capsid,head	Mycobacterium_phage(30.0%)	47	2960147:2960174	2969771:2969798
WP_003413486.1|2931346_2933425_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2933533_2933761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2933757_2935143_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2935487_2935988_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2936004_2936445_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2936591_2937269_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2937253_2937607_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2937619_2938045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2938041_2938716_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2938793_2939615_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2939750_2940644_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2940646_2941465_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2941479_2942661_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2942719_2943151_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2943664_2944906_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2945215_2945578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2945924_2947049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2947050_2947590_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|2947729_2949028_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2949066_2949348_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2949492_2949978_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2950004_2950259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2950262_2952599_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2952627_2952870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2952870_2953548_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2953743_2954400_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2954562_2955009_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2955183_2955516_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2955635_2955995_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2956096_2956555_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2956690_2957071_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2957067_2958564_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2958798_2958990_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2960147:2960174	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2960280_2960712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2960708_2961707_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2961720_2962185_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2962172_2962424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2962594_2964034_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2964041_2964575_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2964727_2965354_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2965385_2965709_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2965788_2966034_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2966030_2967458_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2967459_2967852_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2967848_2968109_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2968125_2968488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2968490_2969618_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2969771:2969798	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_AP018036	Mycobacterium tuberculosis strain HN-506	4413362	3703039	3751999	4413362	protease,tRNA,transposase	Burkholderia_virus(40.0%)	23	NA	NA
WP_087902221.1|3703039_3704301_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3704594_3704756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3704777_3706307_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3706239_3707178_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902446.1|3707186_3708554_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3708622_3709840_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3709935_3711444_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3711440_3712592_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3712782_3713628_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|3714102_3714543_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3714576_3715446_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3715466_3716477_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_172425838.1|3716749_3717394_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_050167889.1|3717460_3718696_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_087902221.1|3718694_3719955_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003900028.1|3720330_3721680_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3721691_3722831_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3722827_3723559_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096362317.1|3723567_3734532_-	PPE family protein	NA	NA	NA	NA	NA
WP_031654342.1|3734580_3735561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417619.1|3740940_3741198_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3741453_3750927_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3751552_3751999_+|transposase	transposase	transposase	NA	NA	NA	NA
