The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018035	Mycobacterium tuberculosis strain HN-321	4421540	890096	939661	4421540	tRNA,protease,transposase,bacteriocin	Burkholderia_virus(28.57%)	44	NA	NA
WP_087902221.1|890096_891358_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_096524150.1|891565_892717_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|892706_893504_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|893500_894508_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|894552_895854_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|895865_896213_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|896206_896863_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|897054_899319_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|899315_899945_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|900065_901022_+	3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA	NA	NA	NA	NA	NA
WP_003898594.1|900966_902565_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|902869_903259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901017.1|903345_904929_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|904959_906054_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|906139_906322_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|906468_907575_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|907657_908527_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|908572_909253_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|909415_909718_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|909719_910553_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|910845_911268_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|911264_912077_-	mannan chain length control protein LmeA	NA	NA	NA	NA	NA
WP_003898599.1|912206_912974_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|912970_913918_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|913960_914737_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|914792_915434_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|915491_917546_-	LCP family protein	NA	NA	NA	NA	NA
WP_003901917.1|917711_918878_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|918965_919982_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003901918.1|920143_920785_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|920865_921921_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|921972_922365_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|922422_922845_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|922806_923097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|923201_924107_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|924125_924941_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|929068_931717_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|932184_932829_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|932809_933361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010950453.1|933441_934164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|934234_935263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|935951_936722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|936808_937621_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087902221.1|938400_939661_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 2
NZ_AP018035	Mycobacterium tuberculosis strain HN-321	4421540	2943093	2981365	4421540	protease,head,tRNA,integrase,capsid,terminase	Mycobacterium_phage(30.0%)	47	2971894:2971921	2981518:2981545
WP_003413486.1|2943093_2945172_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2945280_2945508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031651465.1|2945504_2946890_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2947234_2947735_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2947751_2948192_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2948338_2949016_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2949000_2949354_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2949366_2949792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2949788_2950463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2950540_2951362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2951497_2952391_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2952393_2953212_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2953226_2954408_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2954466_2954898_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2955411_2956653_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2956962_2957325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2957671_2958796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2958797_2959337_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|2959476_2960775_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2960813_2961095_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2961239_2961725_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2961751_2962006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2962009_2964346_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2964374_2964617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2964617_2965295_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2965490_2966147_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2966309_2966756_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2966930_2967263_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2967382_2967742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2967843_2968302_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2968437_2968818_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2968814_2970311_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2970545_2970737_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2971894:2971921	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2972027_2972459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2972455_2973454_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2973467_2973932_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2973919_2974171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2974341_2975781_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_031666072.1|2975788_2976322_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.3	2.0e-05
WP_003899413.1|2976474_2977101_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2977132_2977456_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2977535_2977781_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2977777_2979205_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2979206_2979599_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2979595_2979856_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2979872_2980235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2980237_2981365_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2981518:2981545	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NZ_AP018035	Mycobacterium tuberculosis strain HN-321	4421540	3712760	3761154	4421540	tRNA,transposase,protease	Burkholderia_virus(25.0%)	23	NA	NA
WP_087902221.1|3712760_3714022_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3714315_3714477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3714498_3716028_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3715960_3716899_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003902446.1|3716907_3718275_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3718343_3719561_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3719656_3721165_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3721161_3722313_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3722503_3723349_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|3723823_3724264_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3724297_3725167_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3725187_3726198_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003905041.1|3726470_3727115_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3727181_3728411_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3728693_3730043_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3730054_3731194_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3731190_3731922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096524160.1|3731930_3743000_-	PPE family protein	NA	NA	NA	NA	NA
WP_031654342.1|3743048_3744029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417619.1|3749318_3749576_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3749831_3759305_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3759930_3760377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003911006.1|3760413_3761154_-|transposase	transposase	transposase	NA	NA	NA	NA
