The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP018165	[Mycobacterium] stephanolepidis strain NJB0901	4994485	1929844	1972276	4994485	transposase,integrase,protease	Staphylococcus_phage(20.0%)	37	1952210:1952229	1975985:1976004
WP_096505667.1|1929844_1929976_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162291401.1|1930104_1931184_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096500779.1|1931321_1932842_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.2	2.0e-26
WP_096500781.1|1932858_1934007_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096500783.1|1934014_1934845_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096500785.1|1934864_1935278_-	dehydratase	NA	NA	NA	NA	NA
WP_096500787.1|1935274_1935733_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_096505669.1|1935734_1936922_-	lipid-transfer protein	NA	NA	NA	NA	NA
WP_157997670.1|1937642_1937855_+	ferredoxin	NA	NA	NA	NA	NA
WP_096500791.1|1938045_1939401_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096500793.1|1939962_1940823_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096500795.1|1940819_1942313_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096505671.1|1942526_1943683_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	32.7	1.6e-20
WP_096500797.1|1944175_1945522_+	cytochrome P450	NA	NA	NA	NA	NA
WP_096505673.1|1945560_1946364_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096500799.1|1946360_1947872_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096500803.1|1948165_1949215_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096500806.1|1949583_1950441_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
1952210:1952229	attL	TGTGTCCGAGGGGGGACTTG	NA	NA	NA	NA
WP_096500808.1|1952311_1953457_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	45.3	3.8e-86
WP_096500810.1|1953475_1953772_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157997672.1|1953986_1954685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096505675.1|1954813_1955098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096500814.1|1955305_1955860_+	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	54.4	1.5e-43
WP_096500816.1|1955948_1956296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096505677.1|1956358_1956847_-	HD domain-containing protein	NA	A0A141E1X8	Streptococcus_phage	40.0	4.2e-18
WP_096500818.1|1957108_1959238_-	ATP nucleotide 3'-pyrophosphokinase	NA	NA	NA	NA	NA
WP_096500820.1|1959241_1959556_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_096505679.1|1963755_1964931_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096505439.1|1965079_1965870_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157997673.1|1966084_1966372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096505681.1|1966747_1967434_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157997674.1|1967474_1967807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096500826.1|1967822_1968269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096500828.1|1968610_1969162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096505683.1|1969245_1970115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096500830.1|1970151_1970793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096500834.1|1971226_1972276_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1975985:1976004	attR	TGTGTCCGAGGGGGGACTTG	NA	NA	NA	NA
>prophage 2
NZ_AP018165	[Mycobacterium] stephanolepidis strain NJB0901	4994485	3529961	3556125	4994485	tail	Mycobacterium_phage(80.95%)	31	NA	NA
WP_096503090.1|3529961_3530510_-	hypothetical protein	NA	A0A2K9VF19	Mycobacterium_phage	45.8	3.7e-31
WP_096503092.1|3530502_3530838_-	hypothetical protein	NA	A0A1B3B1R2	Gordonia_phage	43.2	7.1e-09
WP_070927108.1|3530834_3531041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503094.1|3531037_3531334_-	hypothetical protein	NA	A0A2P1JR71	Mycobacterium_phage	42.5	6.0e-12
WP_096503096.1|3531330_3531540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503098.1|3531559_3532693_-	peptidoglycan-binding protein	NA	W8EHB3	Mycobacterium_phage	66.6	9.7e-143
WP_157997709.1|3532694_3533939_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JQW1	Mycobacterium_phage	45.6	5.6e-83
WP_167455693.1|3533997_3534147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503100.1|3534143_3534332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503102.1|3534328_3534640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503106.1|3536682_3537789_-	hypothetical protein	NA	A0A023ZX82	Mycobacterium_phage	55.6	1.7e-115
WP_096503108.1|3537785_3538343_-	hypothetical protein	NA	A0A023ZXQ6	Mycobacterium_phage	41.2	1.3e-23
WP_096503110.1|3538342_3540061_-	hypothetical protein	NA	A0A023ZX29	Mycobacterium_phage	73.5	7.5e-264
WP_096503112.1|3540057_3541164_-	hypothetical protein	NA	A0A023ZWM1	Mycobacterium_phage	63.5	3.1e-146
WP_096503114.1|3541163_3544817_-|tail	phage tail tape measure protein	tail	A0A142F2F1	Mycobacterium_phage	34.2	4.5e-40
WP_096506038.1|3544999_3545245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096506040.1|3545312_3546068_-	hypothetical protein	NA	A0A2K9VEZ9	Mycobacterium_phage	40.9	9.0e-44
WP_096503116.1|3546039_3546324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503118.1|3546338_3546881_-	hypothetical protein	NA	A0A023ZYD0	Mycobacterium_phage	62.2	3.2e-59
WP_096503120.1|3546901_3547324_-	hypothetical protein	NA	A0A023ZX70	Mycobacterium_phage	53.0	5.6e-19
WP_096503122.1|3547320_3547563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503124.1|3547562_3548249_-	hypothetical protein	NA	A0A2K9VET7	Mycobacterium_phage	45.0	1.9e-40
WP_096503126.1|3548242_3548638_-	hypothetical protein	NA	A0A023ZWL1	Mycobacterium_phage	43.6	9.8e-18
WP_096503128.1|3548644_3549067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503130.1|3549063_3550008_-	hypothetical protein	NA	A0A142KC12	Gordonia_phage	59.5	1.8e-105
WP_070927152.1|3550040_3550493_-	hypothetical protein	NA	A0A142KCR7	Gordonia_phage	66.2	5.5e-41
WP_096503132.1|3550494_3551751_-	peptidase	NA	A0A1B3AZ47	Gordonia_phage	43.9	1.2e-69
WP_096503134.1|3551750_3553130_-	hypothetical protein	NA	A0A023ZWK5	Mycobacterium_phage	58.6	9.7e-145
WP_096503136.1|3553180_3554854_-	hypothetical protein	NA	A0A2K9VEU8	Mycobacterium_phage	45.8	4.1e-121
WP_096503138.1|3555514_3555796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096503140.1|3555846_3556125_-	hypothetical protein	NA	A0A218M977	Mycobacterium_phage	52.5	4.3e-12
