The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	14432	84636	1954694	transposase,protease	Streptococcus_phage(17.39%)	51	NA	NA
WP_096493123.1|14432_15356_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.6	6.7e-33
WP_096493125.1|15418_16594_+	MFS transporter	NA	NA	NA	NA	NA
WP_046948552.1|16605_16938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003685635.1|17621_18329_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	7.9e-42
WP_046948551.1|18340_20200_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	1.7e-35
WP_096493127.1|20183_21482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493129.1|21483_22284_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_021815480.1|22298_23114_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	32.7	1.6e-33
WP_096493131.1|23188_24424_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	1.1e-19
WP_096493133.1|24931_25411_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_021815482.1|25625_26051_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_096493135.1|26527_27181_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096493137.1|27164_27650_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_096493139.1|27642_28545_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	4.2e-16
WP_096493141.1|28697_29675_-	choloylglycine hydrolase family protein	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	29.4	5.3e-20
WP_096493143.1|30255_30708_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.1	2.1e-32
WP_003684310.1|30786_32037_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_096493145.1|32972_33965_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	31.9	1.5e-38
WP_096493147.1|33980_35165_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003685663.1|35513_35744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493150.1|35838_37932_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.9	3.3e-120
WP_096493152.1|38232_39693_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_096493154.1|40175_43913_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_096493156.1|43919_47933_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	20.9	8.8e-13
WP_003685671.1|47932_48796_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.4	5.6e-58
WP_096493158.1|49031_50657_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_096493160.1|50950_51307_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	40.0	1.4e-15
WP_057194189.1|55961_56936_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	69.0	3.7e-135
WP_021815495.1|57134_58424_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	37.4	9.2e-73
WP_096493162.1|58750_60133_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_021815497.1|60416_60956_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003685689.1|61074_61806_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_021815498.1|61805_62432_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	39.0	9.7e-36
WP_096493164.1|62518_63865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493166.1|63947_65234_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	1.7e-47
WP_172417807.1|65571_65964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493170.1|66104_67646_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_021815506.1|67642_69139_+	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_021815507.1|69548_70391_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021815508.1|70416_71481_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	5.7e-28
WP_096493172.1|71473_72175_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164475282.1|72299_73448_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_031265085.1|73747_75172_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	34.2	4.3e-71
WP_096493174.1|75624_77001_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_096493176.1|77088_78033_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_096493178.1|78151_79444_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_024500609.1|79456_79693_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_096493180.1|79722_80949_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.8	5.8e-24
WP_096493182.1|80948_82478_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	25.8	6.9e-35
WP_003682395.1|82492_82624_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_096493184.1|83385_84636_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	4.8e-58
>prophage 2
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	89373	155484	1954694	transposase,tRNA	unidentified_phage(19.23%)	54	NA	NA
WP_003682400.1|89373_90672_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.8	6.2e-93
WP_096493188.1|92212_93400_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_046949228.1|93708_95058_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	51.0	7.0e-124
WP_096493192.1|95626_96082_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.1	2.4e-31
WP_054173696.1|96155_97406_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_096493194.1|97929_99303_+	amino acid permease	NA	NA	NA	NA	NA
WP_172417808.1|99702_100689_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	3.1e-44
WP_021815519.1|101652_102396_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	7.0e-33
WP_096493198.1|102399_103854_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_096493200.1|104322_105576_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.7	1.1e-83
WP_015638451.1|105833_106847_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096493202.1|107366_108566_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_096493204.1|108800_109721_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_096493206.1|109909_110647_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_096493208.1|110665_111601_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	32.8	2.7e-13
WP_096493210.1|111614_112448_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	8.7e-16
WP_021815524.1|112460_112661_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_003685747.1|112676_113774_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_096493212.1|113807_114581_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_096493214.1|114852_115995_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.6	1.7e-57
WP_096493216.1|116343_117339_+	LCP family protein	NA	NA	NA	NA	NA
WP_096493218.1|117338_118115_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_096493220.1|118131_118875_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_096493222.1|118895_119657_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_096493224.1|120376_121300_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.4	2.5e-32
WP_096493226.1|121436_122096_+	sugar transferase	NA	NA	NA	NA	NA
WP_096493228.1|122152_123334_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	7.0e-27
WP_172417809.1|123547_124813_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	39.0	1.6e-82
WP_096493232.1|125225_126149_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.6	2.3e-33
WP_172417810.1|126272_127334_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_096493236.1|127417_128557_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.8	5.7e-42
WP_096493238.1|128632_129511_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	7.5e-42
WP_096493240.1|129534_129822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096493242.1|130041_131232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493244.1|131271_132264_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_096493246.1|132595_133843_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_096493248.1|133826_135086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493250.1|135060_136122_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_169790696.1|136426_136594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493252.1|136594_136747_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096493256.1|139780_140746_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.7	1.1e-14
WP_096493258.1|140932_141862_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	1.4e-41
WP_096493260.1|141975_143001_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.7	6.7e-42
WP_096493262.1|143109_143622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148664331.1|143806_144724_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	25.2	2.9e-12
WP_096493264.1|145541_147077_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.0	5.1e-46
WP_096493266.1|147413_147920_-	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	33.6	7.4e-10
WP_015638485.1|148068_148806_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	2.6e-35
WP_096493268.1|149003_150146_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.4	3.6e-28
WP_096493270.1|150145_151441_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_096493272.1|151656_152532_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_172417811.1|152543_152951_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_096493276.1|153704_154160_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	49.3	1.2e-30
WP_096493278.1|154233_155484_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.2e-56
>prophage 3
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	342908	351380	1954694		Enterococcus_phage(33.33%)	10	NA	NA
WP_096493424.1|342908_345080_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	59.5	2.3e-249
WP_004563324.1|345179_345401_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	54.7	3.2e-10
WP_004562759.1|345657_346182_+	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	34.4	1.0e-06
WP_096493426.1|346437_348129_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.6	8.7e-55
WP_004562761.1|348151_348460_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004562762.1|348475_349075_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_004562763.1|349076_349325_+	YaaL family protein	NA	NA	NA	NA	NA
WP_096493428.1|349344_349989_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	3.7e-54
WP_021815679.1|350001_350322_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_021815680.1|350339_351380_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.3	1.6e-27
>prophage 4
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	409556	477975	1954694	transposase,tRNA	Streptococcus_phage(43.48%)	56	NA	NA
WP_012390701.1|409556_410009_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_096493493.1|410087_411338_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.8	5.8e-56
WP_021815712.1|411700_412729_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_096493495.1|412754_413696_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_096493497.1|413798_414599_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_046948247.1|414661_416386_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	60.2	6.7e-196
WP_015638633.1|416600_417236_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_096493500.1|417241_417472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493502.1|417571_419587_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_096493504.1|419596_422458_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	3.4e-301
WP_096493506.1|422547_423633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493508.1|423851_424721_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.7	3.4e-10
WP_096493510.1|424742_425717_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	53.7	1.8e-92
WP_046948254.1|425737_426676_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	36.8	6.8e-49
WP_096493512.1|426737_428024_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	6.6e-47
WP_096493514.1|428275_428917_-	TenA family protein	NA	NA	NA	NA	NA
WP_021815720.1|429030_429621_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	2.7e-56
WP_012390875.1|432583_433597_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_021815722.1|433678_434884_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_003682638.1|434989_435757_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012390876.1|435873_437196_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.3	2.0e-171
WP_096493518.1|437390_438785_+	amino acid permease	NA	NA	NA	NA	NA
WP_096493520.1|438874_440425_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_004563267.1|440487_440727_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_096493522.1|440779_443173_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.2	1.1e-87
WP_003682651.1|443193_443667_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.8	4.0e-42
WP_031265166.1|443694_444276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493524.1|444416_445106_+	uracil-DNA glycosylase	NA	V5NWU7	Chelonid_alphaherpesvirus	44.6	5.7e-45
WP_096493526.1|445139_446114_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003682659.1|446122_446575_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_004563263.1|446574_447090_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004563262.1|447219_447759_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.4	4.8e-23
WP_031265168.1|447886_448783_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_031265170.1|448794_449625_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_096493528.1|449629_450508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682665.1|450547_451906_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.9	3.6e-19
WP_046949065.1|452119_453940_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	35.5	2.6e-89
WP_004563258.1|454220_454532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493530.1|454541_456392_+	acetyltransferase	NA	NA	NA	NA	NA
WP_172417816.1|456422_457241_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_021815732.1|457561_458152_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	53.7	1.6e-27
WP_096493534.1|458555_459584_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_046949063.1|459704_460610_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	41.2	7.5e-05
WP_021815735.1|461756_462596_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.1	2.3e-48
WP_021815736.1|462758_463274_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_096493536.1|463506_464448_-	Dyp-type peroxidase	NA	A0A0B5JDC7	Pandoravirus	31.1	2.4e-09
WP_096493538.1|465178_466429_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	2.4e-57
WP_003685816.1|466927_467911_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_096493540.1|467930_468734_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003682688.1|468762_469683_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_021815739.1|469683_470034_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_096493542.1|470643_471957_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021815740.1|473291_474014_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096493544.1|474013_475516_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.7	1.3e-33
WP_096493546.1|475718_476579_+	sugar transporter	NA	NA	NA	NA	NA
WP_096493548.1|476688_477975_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	5.1e-47
>prophage 5
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	483058	542832	1954694	transposase,tRNA,head,protease	Lactobacillus_phage(25.0%)	58	NA	NA
WP_021815749.1|483058_483760_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_021815751.1|484780_485557_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_021815752.1|485663_486371_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003682708.1|486622_486952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021815753.1|487337_487982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493554.1|488140_488602_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096493556.1|491583_492942_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096493558.1|493069_493522_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	4.0e-31
WP_096493560.1|495834_496854_+	serine hydrolase	NA	NA	NA	NA	NA
WP_096493562.1|496853_498341_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_021815756.1|498647_498953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493564.1|498964_499696_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_021815758.1|499695_501033_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_012390912.1|501311_501902_+	thymidine kinase	NA	A0A060AH87	Cronobacter_phage	55.1	4.7e-48
WP_172417834.1|501907_502990_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_021815760.1|502982_503834_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_096493566.1|503852_504884_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.1	2.7e-51
WP_003685860.1|505007_506243_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.4	1.5e-96
WP_096493568.1|506382_507018_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_096493570.1|507212_508331_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003685864.1|508327_509101_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_021815763.1|510828_511539_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003682741.1|511567_511780_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_046949059.1|511825_512332_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021815764.1|512324_512870_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003685872.1|512897_514436_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_021815765.1|514467_515403_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003682746.1|515425_516847_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003685876.1|516858_517281_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003682748.1|517516_517738_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_021815767.1|517747_518971_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003685879.1|519045_520062_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003682754.1|520062_520305_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	46.5	3.5e-10
WP_003682755.1|520314_520539_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_021815768.1|520593_521796_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_096493572.1|521807_522095_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_012390926.1|522302_523280_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_096493574.1|523349_524483_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_096493576.1|524901_525747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021815770.1|525802_526282_-	universal stress protein	NA	NA	NA	NA	NA
WP_024500751.1|526360_526765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493578.1|526926_528219_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.1	1.1e-102
WP_021815773.1|528215_528689_-	YueI family protein	NA	NA	NA	NA	NA
WP_003685895.1|528778_529189_-	VOC family protein	NA	NA	NA	NA	NA
WP_096493580.1|529218_529965_-	fructose permease	NA	NA	NA	NA	NA
WP_003685899.1|530200_531046_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	27.9	3.7e-14
WP_046949038.1|531298_531499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493582.1|531488_531809_+|head	head protein	head	Q6SED4	Lactobacillus_prophage	54.2	1.2e-26
WP_046949039.1|531852_532044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350214.1|532151_532319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682773.1|532306_532912_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_021815802.1|533241_534951_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_021815803.1|535131_536280_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	9.2e-32
WP_003682780.1|536292_537513_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_096493584.1|537901_539197_+	GntP family permease	NA	NA	NA	NA	NA
WP_021815805.1|539209_540352_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	3.8e-38
WP_096493586.1|541684_541936_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	91.6	9.6e-35
WP_148664334.1|541989_542832_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.1	4.5e-153
>prophage 6
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	655119	720426	1954694	transposase,tRNA,protease	Streptococcus_phage(15.79%)	59	NA	NA
WP_021815862.1|655119_657912_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	25.0	5.4e-78
WP_003686347.1|658052_658265_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003682114.1|658266_658815_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096493673.1|658815_659052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350339.1|659064_659772_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_021815865.1|659771_660116_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_012391004.1|660222_661356_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_046948622.1|661653_663249_+	amidohydrolase	NA	NA	NA	NA	NA
WP_096493675.1|663357_664290_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003682107.1|664498_665155_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003682106.1|665169_665859_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096493677.1|665859_668406_+	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	2.4e-32
WP_021815870.1|668476_669463_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	31.3	8.4e-34
WP_021815871.1|669495_669924_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_096493679.1|670147_671122_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	24.2	1.0e-07
WP_003682101.1|671381_671597_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003682098.1|671723_672170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493681.1|672280_672850_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.7	9.8e-11
WP_024500785.1|672983_673265_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_096493683.1|673268_674033_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_003682090.1|674110_675958_+	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	33.3	2.1e-22
WP_096493685.1|676060_677260_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003686372.1|677246_677543_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003682085.1|677545_678106_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_096493687.1|678110_678632_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_021816683.1|678615_679665_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_096493166.1|679716_681003_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	1.7e-47
WP_172417818.1|681214_681883_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096493691.1|681937_682417_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	7.0e-34
WP_021350134.1|682417_684655_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	1.6e-27
WP_096493693.1|684672_685701_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_003682071.1|685940_686195_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003682069.1|686440_686710_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_096493695.1|688395_690195_+	ribonuclease J	NA	NA	NA	NA	NA
WP_096493697.1|690285_691182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021815882.1|691363_692554_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.2	3.9e-33
WP_096493699.1|692724_694032_+	trigger factor	NA	NA	NA	NA	NA
WP_096493701.1|694182_695433_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.9	8.2e-135
WP_096493703.1|695446_696040_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|696039_696339_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_012391021.1|696605_696752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172417835.1|696954_697686_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	7.9e-29
WP_096493707.1|697963_699775_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003682046.1|699839_701147_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_096493709.1|701173_702106_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_171029993.1|702132_702966_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096493711.1|703038_705336_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	5.8e-70
WP_031265225.1|705355_705877_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.3	8.7e-30
WP_003682040.1|706658_707657_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	34.0	1.8e-47
WP_096493713.1|707802_708990_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096493715.1|709204_710491_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.0	3.5e-48
WP_096493717.1|710717_711809_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_148664336.1|713229_713427_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021815895.1|713603_715193_-	asparagine synthase B	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	39.3	1.4e-102
WP_096493719.1|716181_716622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046949146.1|716632_717622_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|717643_718090_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
WP_046949145.1|718190_718811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493721.1|719238_720426_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	740545	792340	1954694	transposase,tRNA,protease	Faecalibacterium_phage(14.29%)	42	NA	NA
WP_096493741.1|740545_741562_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.2	4.3e-33
WP_096493743.1|741690_741984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493745.1|741967_744238_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.7	2.8e-125
WP_096493747.1|744323_745454_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	1.1e-32
WP_172417819.1|745590_745848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096493751.1|745915_746839_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.1	1.8e-30
WP_021816814.1|749978_750293_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_172417836.1|753654_753894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493755.1|754370_755540_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685235.1|755888_756515_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_012391088.1|756670_756922_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|756998_757226_+	YneF family protein	NA	NA	NA	NA	NA
WP_096493757.1|757292_757925_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_096493759.1|758020_758773_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003681959.1|758765_759056_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	38.0	1.4e-05
WP_096493761.1|759209_759992_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_021815939.1|760082_760961_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681954.1|761041_761767_+	UMP kinase	NA	NA	NA	NA	NA
WP_021815941.1|761766_762327_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_164475267.1|762459_763227_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.3	6.6e-18
WP_012391092.1|763243_764032_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_096493765.1|764053_765325_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_096493767.1|765358_767080_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	26.5	6.2e-08
WP_096493769.1|767219_771563_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	30.8	1.9e-16
WP_096493771.1|771837_773124_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	3.9e-47
WP_096493773.1|773164_774316_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.3e-21
WP_096493775.1|774328_775075_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_096493777.1|775084_776287_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_096493779.1|776313_777339_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_021815949.1|777584_778655_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.0	6.3e-51
WP_096493781.1|778647_781737_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003681934.1|781888_782368_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_096493783.1|782387_783614_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003681930.1|783650_783953_+	YlxR family protein	NA	NA	NA	NA	NA
WP_096493785.1|783945_784269_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_096493787.1|784273_786601_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003685195.1|786613_786976_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003685192.1|787045_787942_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_096493789.1|787952_788918_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_096493791.1|789032_790421_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_096493793.1|790626_791814_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096494916.1|791914_792340_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	29.2	1.1e-09
>prophage 8
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	805093	866025	1954694	transposase,tRNA	Streptococcus_phage(26.67%)	51	NA	NA
WP_042513950.1|805093_806452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096493804.1|806731_807250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021815971.1|807285_807909_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_172417820.1|808000_809023_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_096494918.1|809282_810356_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	48.2	4.5e-89
WP_096493808.1|810367_811543_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.0	1.4e-88
WP_148664343.1|813185_813527_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	45.5	2.3e-23
WP_003685099.1|813734_814907_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_096493810.1|815197_815650_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.8	2.3e-31
WP_096493812.1|815728_816979_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.2	1.6e-53
WP_046948485.1|817213_817825_-	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_046948484.1|817825_818506_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003681833.1|818680_819220_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_172417821.1|819523_819664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493814.1|819753_820602_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096493816.1|820614_821136_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_124891200.1|821951_822857_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	28.7	8.9e-14
WP_096493822.1|823076_823520_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_046948482.1|823534_824347_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_096493824.1|827255_829223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493826.1|829476_830043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493828.1|830220_831174_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_031265302.1|831766_832060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003681791.1|832115_833078_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_021816003.1|833077_833827_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_031265305.1|833886_834228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096493830.1|834243_836478_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A218M393	Acidovorax_phage	43.5	6.8e-07
WP_003681786.1|836487_836925_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_096493833.1|837281_837770_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096493835.1|838118_839315_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015638883.1|840479_841259_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048339923.1|841273_841798_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021349562.1|841819_842563_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021349561.1|842495_843251_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.5e-30
WP_096493837.1|843265_844423_+	amidohydrolase	NA	NA	NA	NA	NA
WP_048339920.1|844423_845842_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.2	1.9e-10
WP_172417822.1|845795_847094_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_021816007.1|847463_848123_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021816008.1|848103_848775_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_096493841.1|848785_849526_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.2e-37
WP_021816010.1|849541_850396_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096493843.1|850707_851451_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.0e-20
WP_096493845.1|851629_852796_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_096493847.1|852802_853627_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_096493849.1|855771_857022_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	5.3e-57
WP_021816012.1|857678_858518_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_096493851.1|858519_859500_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.2	1.9e-17
WP_003681741.1|860855_862151_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	26.3	7.7e-27
WP_046948467.1|862154_863930_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096493853.1|864231_864912_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_096493855.1|864999_866025_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	8.2e-40
>prophage 9
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	917392	925663	1954694	tRNA	Staphylococcus_phage(28.57%)	8	NA	NA
WP_096493896.1|917392_918595_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.6	1.3e-44
WP_003683172.1|918607_920494_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.0	2.2e-51
WP_096493898.1|920559_921519_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.4	2.7e-117
WP_021816051.1|921530_922034_+	dihydrofolate reductase	NA	A0A1Y0SUI9	Pseudomonas_phage	35.4	1.6e-20
WP_021816052.1|922013_922643_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_021816053.1|922811_923654_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	3.0e-16
WP_096493900.1|923788_924967_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	36.5	2.5e-61
WP_096493902.1|925036_925663_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.8	1.2e-12
>prophage 10
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	988496	1069647	1954694	transposase,integrase	Streptococcus_phage(25.0%)	59	1001202:1001225	1005917:1005940
WP_096493965.1|988496_989747_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_096493967.1|991895_992360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172417824.1|994685_995114_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096493969.1|995261_996140_-	sugar transporter	NA	NA	NA	NA	NA
WP_046948724.1|998897_999104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172417837.1|1000312_1001227_-	DUF3737 family protein	NA	NA	NA	NA	NA
1001202:1001225	attL	GGGAGTGTAAAATATTTTGTGTAA	NA	NA	NA	NA
WP_096493971.1|1001314_1002508_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_046949190.1|1002722_1003343_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.8	7.9e-22
WP_096494922.1|1003603_1004419_-	alpha/beta hydrolase	NA	A0A0A0RRH5	Mycobacterium_phage	25.6	2.0e-09
WP_096493972.1|1004402_1005836_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_088460944.1|1006223_1006469_+	hypothetical protein	NA	NA	NA	NA	NA
1005917:1005940	attR	TTACACAAAATATTTTACACTCCC	NA	NA	NA	NA
WP_096493974.1|1006465_1006861_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	41.6	9.2e-08
WP_096494924.1|1006916_1007258_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q708N9	Streptococcus_phage	53.1	6.7e-07
WP_096493978.1|1013189_1013948_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_096493980.1|1014168_1014546_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_046026009.1|1015499_1016570_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_096493982.1|1016793_1017936_-	PLP-dependent transferase	NA	A0A2I2L687	Orpheovirus	26.0	1.4e-08
WP_021816107.1|1017948_1018860_-	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	40.8	3.1e-59
WP_096493984.1|1019201_1019468_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_021816108.1|1019477_1020821_+	PFL family protein	NA	NA	NA	NA	NA
WP_003682993.1|1021011_1021944_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_021816110.1|1022024_1022417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057727642.1|1024601_1024964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493988.1|1025037_1025955_-	EamA family transporter	NA	NA	NA	NA	NA
WP_096493990.1|1026886_1028740_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	60.2	3.1e-207
WP_096493991.1|1029889_1030747_+	patatin family protein	NA	NA	NA	NA	NA
WP_096493993.1|1030844_1032017_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_096493995.1|1032026_1033127_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003684752.1|1034129_1034627_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	54.3	1.8e-45
WP_003682972.1|1035687_1036887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475275.1|1036902_1037079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096493997.1|1037086_1037944_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096493999.1|1038082_1040431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494000.1|1040770_1041658_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096494001.1|1041748_1042636_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_096494003.1|1042710_1044081_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_096494005.1|1044080_1044812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494007.1|1044931_1046317_-	amino acid permease	NA	NA	NA	NA	NA
WP_096494009.1|1046591_1047554_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_096494011.1|1047870_1049649_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_096494013.1|1049808_1051044_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_096494014.1|1051047_1051728_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_014562434.1|1051820_1052258_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.2	1.6e-24
WP_096494926.1|1052263_1052806_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494928.1|1052896_1053430_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_057194743.1|1053578_1053851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494016.1|1053991_1055107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682939.1|1055585_1056416_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096494019.1|1056609_1058253_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.6e-45
WP_096494021.1|1058409_1059741_-	guanine deaminase	NA	NA	NA	NA	NA
WP_096494023.1|1059862_1061014_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_004563086.1|1061921_1062338_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	36.6	6.3e-15
WP_096494025.1|1062334_1063018_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.7	1.1e-11
WP_004563088.1|1063101_1063530_-	NADH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004563089.1|1063644_1064151_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494027.1|1064202_1064970_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_096494029.1|1064962_1065604_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-21
WP_096494031.1|1065948_1067631_-	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	4.9e-34
WP_096494033.1|1068723_1069647_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	7.4e-32
>prophage 11
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1204153	1263200	1954694	transposase,tRNA,integrase	Bacillus_phage(28.57%)	49	1256939:1256997	1269222:1269280
WP_054173696.1|1204153_1205404_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_096494178.1|1206197_1207331_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003683293.1|1207373_1207823_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096494180.1|1207826_1209008_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_096494182.1|1209115_1211050_-	GTP-binding protein	NA	D0R0F5	Streptococcus_phage	29.2	4.8e-65
WP_172417826.1|1211583_1211946_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_096494186.1|1212053_1212650_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_021349975.1|1212742_1213378_+	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	36.2	3.3e-23
WP_096494188.1|1213370_1215635_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_096494190.1|1215749_1216661_-	EamA family transporter	NA	NA	NA	NA	NA
WP_096494192.1|1216784_1217804_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_096494195.1|1218239_1219247_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003683269.1|1219346_1220075_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_096494197.1|1220166_1221462_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	29.2	3.8e-50
WP_096494199.1|1221488_1222007_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_096494201.1|1222057_1224898_-	3'-5' exoribonuclease	NA	A0A1X9I5C8	Streptococcus_phage	29.5	1.8e-81
WP_046948511.1|1225127_1226063_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_096494203.1|1226064_1227054_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_021816276.1|1227073_1228183_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683262.1|1228238_1229324_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004563232.1|1229480_1230278_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.4	2.6e-09
WP_096494205.1|1230288_1231140_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_096494207.1|1231165_1232101_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_096494209.1|1232072_1232936_-	phosphate ABC transporter substrate-binding protein	NA	H6WG65	Cyanophage	29.2	9.1e-08
WP_096494213.1|1233307_1234471_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_096494936.1|1235108_1236482_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096494215.1|1236610_1237417_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_096494217.1|1237526_1238444_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_096494219.1|1238456_1241636_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_096494221.1|1241635_1242718_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	5.6e-55
WP_096494223.1|1242719_1244009_-	dihydroorotase	NA	NA	NA	NA	NA
WP_096494225.1|1244008_1244974_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	29.6	3.8e-23
WP_075667795.1|1245672_1245960_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096494227.1|1245983_1246862_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	7.5e-42
WP_021350245.1|1248134_1248425_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_021350246.1|1248434_1249466_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_024501029.1|1249462_1250119_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_096494229.1|1250122_1251001_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_096494231.1|1251022_1252936_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_096494233.1|1252932_1253673_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_021350250.1|1253685_1256124_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
1256939:1256997	attL	AACCTAAATTGCAAGATTAAGTGAGCCACCCGGCCACGGGAGTGGCCGAGGTTTATACT	NA	NA	NA	NA
WP_096494235.1|1256990_1258130_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	9.4e-45
WP_003683897.1|1258299_1258659_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003683895.1|1258779_1260207_-	amino acid permease	NA	NA	NA	NA	NA
WP_046948494.1|1260217_1260976_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004563245.1|1260975_1261485_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004563246.1|1261609_1261870_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_003683887.1|1261884_1262160_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_096494237.1|1262642_1263200_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	27.2	2.4e-09
1269222:1269280	attR	AACCTAAATTGCAAGATTAAGTGAGCCACCCGGCCACGGGAGTGGCCGAGGTTTATACT	NA	NA	NA	NA
>prophage 12
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1313005	1321794	1954694	transposase	Lactobacillus_phage(50.0%)	12	NA	NA
WP_096494287.1|1313005_1313512_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	30.1	2.5e-05
WP_021816827.1|1313501_1313735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494289.1|1315264_1315561_-	helix-turn-helix transcriptional regulator	NA	O21995	Streptococcus_virus	50.8	1.5e-10
WP_096494291.1|1315723_1316341_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	45.2	2.7e-38
WP_096494293.1|1316472_1316835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494295.1|1316859_1317435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148664340.1|1317903_1318320_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	82.7	7.4e-16
WP_096494938.1|1318417_1318762_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	47.6	4.5e-19
WP_096494297.1|1318773_1319055_+	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	71.6	1.9e-31
WP_096494299.1|1319051_1319786_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	51.4	3.2e-30
WP_070955490.1|1319953_1321141_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096494301.1|1321248_1321794_+	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	62.3	6.1e-18
>prophage 13
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1429630	1499533	1954694	transposase,protease	Streptococcus_phage(23.53%)	46	NA	NA
WP_046948925.1|1429630_1430617_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	1.6e-45
WP_003684211.1|1437013_1437262_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_096494402.1|1437595_1438615_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_096494405.1|1438616_1439642_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_096494407.1|1439634_1440852_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_096494942.1|1441067_1442798_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_021816385.1|1442799_1443066_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_004563060.1|1443195_1443438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494409.1|1443611_1445858_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	3.8e-122
WP_021816387.1|1446109_1446817_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_096494411.1|1446943_1447519_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	36.3	4.4e-27
WP_096494413.1|1447511_1448939_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.6	3.2e-98
WP_021816389.1|1449223_1449817_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_096494415.1|1449972_1450692_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_096494417.1|1450702_1451491_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.5	7.5e-25
WP_096494419.1|1451480_1452365_+	DMT family transporter	NA	NA	NA	NA	NA
WP_172417839.1|1452443_1453688_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_015639300.1|1453995_1454139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494423.1|1454329_1455013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494425.1|1455025_1455886_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	4.8e-17
WP_096494427.1|1455872_1456250_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494429.1|1456359_1457292_-	dTDP-glucose 4,6-dehydratase	NA	M1H4P8	Acanthocystis_turfacea_Chlorella_virus	39.6	1.5e-56
WP_096494431.1|1457319_1459065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494433.1|1459110_1460019_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_096494435.1|1460036_1461089_-	sugar transferase	NA	NA	NA	NA	NA
WP_096494437.1|1461106_1462687_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	25.3	5.1e-33
WP_096494439.1|1462905_1463883_-	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	37.0	3.5e-48
WP_096494441.1|1463978_1465085_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_096494443.1|1465084_1466017_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.7	1.9e-75
WP_096494445.1|1466106_1466664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494447.1|1466806_1468402_-	C40 family peptidase	NA	A0A1W6DXV0	Rhodococcus_phage	48.7	1.6e-13
WP_096494449.1|1470093_1471464_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	5.3e-10
WP_164475278.1|1473515_1482965_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_096493232.1|1483613_1484537_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.6	2.3e-33
WP_096494453.1|1484716_1486567_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	42.3	2.7e-25
WP_096494455.1|1486712_1487771_-	acyltransferase	NA	NA	NA	NA	NA
WP_096494457.1|1487780_1489199_-	flippase	NA	NA	NA	NA	NA
WP_003684138.1|1489201_1490323_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.8	7.5e-172
WP_096494459.1|1490437_1491055_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_096494461.1|1491029_1492253_-	polymerase	NA	NA	NA	NA	NA
WP_021816405.1|1492263_1493025_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_003684127.1|1495004_1495220_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_096494463.1|1495400_1496297_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_096494465.1|1497456_1498707_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	4.5e-56
WP_012390701.1|1498785_1499238_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_096494467.1|1499314_1499533_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1512451	1562976	1954694	holin,protease,tail,tRNA,head,transposase,integrase	Streptococcus_phage(15.0%)	45	1553053:1553085	1556685:1556717
WP_172417828.1|1512451_1513438_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.9	1.6e-45
WP_096494483.1|1514128_1514689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494485.1|1515164_1516424_-	LCP family protein	NA	NA	NA	NA	NA
WP_003684094.1|1516645_1517194_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494487.1|1517218_1517950_+	MFS transporter	NA	NA	NA	NA	NA
WP_096494489.1|1518074_1518551_+	MFS transporter	NA	NA	NA	NA	NA
WP_046948780.1|1518593_1519112_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.2	2.7e-31
WP_096494491.1|1519202_1519796_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096494493.1|1519812_1520034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494495.1|1520070_1520760_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	40.7	6.9e-35
WP_096494497.1|1521527_1521971_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_046948783.1|1522112_1523651_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_096494501.1|1523714_1524221_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_096494503.1|1524296_1525079_+	dimethylargininase	NA	NA	NA	NA	NA
WP_096494505.1|1525466_1526864_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_096494507.1|1527020_1528061_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_096494509.1|1528938_1530189_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_096494511.1|1530924_1531644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494513.1|1532132_1533254_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_096494515.1|1533695_1533965_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_096494517.1|1533961_1534216_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_096494519.1|1534364_1535177_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	33.3	4.1e-10
WP_096494521.1|1535280_1535940_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_096494523.1|1536825_1537182_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_096494525.1|1538171_1539392_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	44.5	1.5e-88
WP_045353779.1|1539623_1540811_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	5.8e-05
WP_096494527.1|1540807_1541647_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_096494529.1|1542538_1543726_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096494531.1|1544333_1545434_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_096494533.1|1545449_1546541_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_096494535.1|1546596_1548072_-	FAD-binding protein	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	27.7	2.5e-21
WP_096494537.1|1548384_1550265_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	35.9	1.5e-100
WP_096494539.1|1550248_1551208_+	beta-galactosidase small subunit	NA	NA	NA	NA	NA
WP_096494944.1|1551386_1552085_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	4.0e-22
WP_096494541.1|1552021_1552930_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	27.3	1.1e-14
1553053:1553085	attL	ATTTTGCCAATGACTGGCTAACCTCATTCTACA	NA	NA	NA	NA
WP_096494543.1|1553360_1554284_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.6	1.8e-33
WP_096494545.1|1554543_1555629_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_096494547.1|1556111_1556684_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	27.2	2.4e-09
WP_096494549.1|1557451_1557730_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	40.4	3.8e-08
1556685:1556717	attR	TGTAGAATGAGGTTAGCCAGTCATTGGCAAAAT	NA	NA	NA	NA
WP_096494551.1|1557730_1558111_+|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	29.9	3.7e-06
WP_172417829.1|1558100_1558511_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	61.0	4.3e-40
WP_096494553.1|1558507_1559386_+	1,4-beta-N-acetylmuramidase	NA	A0A2K9V3I9	Faecalibacterium_phage	36.0	8.3e-25
WP_075667470.1|1559478_1559709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494555.1|1559744_1561406_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.0	6.5e-103
WP_096494557.1|1561398_1562976_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	49.9	3.9e-134
>prophage 15
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1619889	1745626	1954694	transposase,tRNA,protease	Lactobacillus_phage(16.67%)	105	NA	NA
WP_096494597.1|1619889_1622394_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.8	1.7e-126
WP_021816464.1|1622412_1622883_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012391602.1|1624496_1625516_-	alcohol dehydrogenase AdhP	NA	E3SJ82	Synechococcus_phage	27.1	3.3e-17
WP_021816465.1|1625802_1626519_+|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_096494599.1|1626536_1627247_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_080963713.1|1627279_1627537_-	hypothetical protein	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.5	1.9e-06
WP_096494601.1|1628713_1629646_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.1	3.0e-41
WP_096494605.1|1630778_1631261_-	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_096494607.1|1631300_1631780_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_096494609.1|1632127_1632958_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_172417830.1|1633016_1633304_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096494611.1|1633276_1633597_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015639408.1|1633609_1633780_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003681522.1|1634519_1635161_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.5	5.4e-58
WP_172417841.1|1635291_1636785_-	amino acid permease	NA	NA	NA	NA	NA
WP_096494615.1|1637091_1637559_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096494617.1|1637603_1638413_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046948196.1|1638631_1639300_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_096494619.1|1639354_1639843_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003681510.1|1639852_1640602_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_004562929.1|1640773_1640974_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	6.9e-20
WP_004562927.1|1641123_1641783_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_021816479.1|1641935_1642841_+	cation transporter	NA	NA	NA	NA	NA
WP_021816480.1|1642995_1643691_-	VIT family protein	NA	NA	NA	NA	NA
WP_046948210.1|1643708_1644392_-	VIT family protein	NA	NA	NA	NA	NA
WP_021816481.1|1644541_1645018_-	universal stress protein	NA	NA	NA	NA	NA
WP_003681491.1|1645221_1645656_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096494621.1|1645704_1646919_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004562921.1|1647089_1648922_-	ribonuclease J	NA	NA	NA	NA	NA
WP_021816486.1|1649193_1649535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172417831.1|1649629_1650067_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494625.1|1651703_1652408_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_096494627.1|1653483_1654368_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.3	2.4e-11
WP_096494629.1|1654641_1657230_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_096494631.1|1657505_1658090_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_035436408.1|1658105_1659104_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_096494633.1|1659579_1660743_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.4	4.0e-160
WP_080946662.1|1661312_1661975_-	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	29.1	4.5e-07
WP_096494635.1|1661992_1663330_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_021816496.1|1663404_1664298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494637.1|1665879_1666491_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.5	2.3e-50
WP_096494639.1|1666510_1667863_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	54.8	2.9e-53
WP_012390701.1|1669420_1669873_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_096494641.1|1671360_1671762_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_003681444.1|1672055_1672643_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	41.6	2.8e-24
WP_096494643.1|1672863_1674822_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_096494952.1|1674970_1675981_-	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	28.0	2.5e-25
WP_096494645.1|1676432_1677908_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.2	2.2e-17
WP_096494647.1|1677920_1679297_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_096494649.1|1680671_1681787_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.5	2.5e-106
WP_014081459.1|1681846_1682245_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_096494651.1|1682388_1683258_-	phosphate--nucleotide phosphotransferase	NA	NA	NA	NA	NA
WP_004562892.1|1683328_1683934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494653.1|1684824_1685745_+	serine hydrolase	NA	NA	NA	NA	NA
WP_096494655.1|1685968_1687222_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	21.8	3.6e-05
WP_004562888.1|1687362_1687911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021816513.1|1688090_1689122_+	lactonase family protein	NA	NA	NA	NA	NA
WP_096494657.1|1689214_1689802_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_096494659.1|1689798_1690113_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_096494661.1|1690121_1693118_-	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	27.8	8.0e-27
WP_096494663.1|1693130_1693547_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_096494665.1|1693599_1694145_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494667.1|1694809_1695415_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_096494669.1|1697143_1698331_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096494671.1|1698433_1699177_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_172417832.1|1699561_1700254_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_096494675.1|1700982_1702341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096494954.1|1702670_1703399_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_003681397.1|1703501_1703735_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003681394.1|1704117_1704594_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_096494677.1|1704654_1705770_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.9	1.2e-73
WP_096494679.1|1706162_1706582_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_014562645.1|1706650_1707661_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.9	9.8e-62
WP_096494681.1|1708052_1708574_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096494683.1|1708870_1710391_+	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	28.0	6.4e-33
WP_096494685.1|1710387_1710846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096494687.1|1711091_1711514_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096494689.1|1711790_1712525_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_096494691.1|1712525_1713542_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_003681368.1|1713544_1713973_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_096494693.1|1713944_1715333_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_096494695.1|1715319_1716069_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_096494697.1|1716081_1717293_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_096494699.1|1717500_1718670_-	MFS transporter	NA	NA	NA	NA	NA
WP_012390701.1|1718744_1719197_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_096494701.1|1719275_1720526_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_096494703.1|1721256_1722588_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	28.1	4.5e-06
WP_003681362.1|1722741_1723056_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	34.0	1.4e-14
WP_096494705.1|1723203_1724130_+	AEC family transporter	NA	NA	NA	NA	NA
WP_096494707.1|1724070_1724319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035423707.1|1724686_1726039_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_023466279.1|1726019_1727474_-	amino acid permease	NA	NA	NA	NA	NA
WP_096494711.1|1728398_1729229_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012391669.1|1729957_1731340_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_021816535.1|1731339_1732629_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_096494713.1|1732836_1734714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021816539.1|1734706_1734913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021816545.1|1735156_1735477_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003681316.1|1735524_1736097_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003684310.1|1736559_1737810_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_096494717.1|1738021_1739209_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_096494719.1|1739538_1741149_-	family 78 glycoside hydrolase catalytic domain	NA	NA	NA	NA	NA
WP_096494956.1|1741149_1741833_-	nicotinamide mononucleotide transporter	NA	U5J9C5	Bacillus_phage	35.0	3.8e-25
WP_096494721.1|1742991_1744545_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.0	1.7e-17
WP_096494723.1|1744660_1745626_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.0	1.2e-13
>prophage 16
NZ_AP017973	Lactobacillus fermentum strain MTCC 25067	1954694	1752280	1825310	1954694	transposase	Streptococcus_phage(23.81%)	51	NA	NA
WP_096494735.1|1752280_1753513_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.0e-57
WP_003685321.1|1756050_1756974_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.8	1.2e-29
WP_096494738.1|1757084_1757636_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096494740.1|1758894_1760988_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.3	5.2e-150
WP_096494742.1|1761221_1762127_+	DMT family transporter	NA	NA	NA	NA	NA
WP_069775800.1|1762219_1764514_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003681298.1|1764696_1765353_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_096494744.1|1765477_1766122_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	30.2	4.8e-06
WP_096494746.1|1766143_1767421_+	GTPase HflX	NA	NA	NA	NA	NA
WP_054173696.1|1767710_1768961_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.4e-57
WP_172417833.1|1771714_1773313_-	APC family permease	NA	NA	NA	NA	NA
WP_003681285.1|1773486_1773984_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096494750.1|1774765_1775953_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_031265503.1|1779262_1779799_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021816560.1|1780024_1781068_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_021816561.1|1781321_1782239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096494752.1|1782250_1782712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681269.1|1782812_1783262_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_046948920.1|1783302_1783887_-	guanylate kinase	NA	S4W1R9	Pandoravirus	34.5	5.5e-09
WP_046948919.1|1783886_1784303_-	NUDIX domain-containing protein	NA	A0A2H4UTN1	Bodo_saltans_virus	31.3	5.3e-06
WP_096494754.1|1784403_1785807_+	amino acid permease	NA	NA	NA	NA	NA
WP_096494756.1|1785961_1787212_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.0e-56
WP_012390701.1|1787290_1787743_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.8e-32
WP_096494758.1|1788161_1790558_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_024501211.1|1790639_1791551_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003681263.1|1791572_1792211_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_096494760.1|1792529_1794245_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_096494762.1|1794473_1795424_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	52.7	2.2e-92
WP_096494764.1|1795433_1796354_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	30.9	7.9e-26
WP_096494766.1|1796364_1798530_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	57.9	4.3e-240
WP_003681257.1|1798526_1798988_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_015639530.1|1799341_1799941_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_021349773.1|1799933_1800077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031265507.1|1800295_1801369_-	phosphoesterase	NA	A0A289YMW0	Serratia_phage	25.9	1.3e-08
WP_021816571.1|1803560_1804553_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003685380.1|1804552_1805452_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_096494768.1|1805444_1806206_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	26.9	2.5e-09
WP_096494772.1|1806750_1807965_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.7	6.5e-28
WP_096494774.1|1808201_1809521_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_041813090.1|1809805_1810681_-	ROK family protein	NA	NA	NA	NA	NA
WP_096494776.1|1810700_1812053_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_096494778.1|1812223_1813207_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003685393.1|1813190_1814075_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	27.9	8.1e-20
WP_096494780.1|1814194_1815115_-	ribokinase	NA	NA	NA	NA	NA
WP_003681231.1|1818273_1818594_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	41.6	3.2e-19
WP_096494785.1|1818568_1819378_-	TerC family protein	NA	S5MAL1	Bacillus_phage	44.4	4.5e-41
WP_096494787.1|1819434_1820322_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_046949236.1|1820411_1821332_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_096494789.1|1821682_1822969_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	2.3e-47
WP_096494791.1|1823033_1824365_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.3	7.9e-27
WP_148664346.1|1824419_1825310_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.1	3.5e-39
