The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	268893	371801	6583377	plate,terminase,lysis,protease,tail,holin,capsid,portal,integrase,head	Pseudomonas_virus(33.33%)	107	307724:307771	341729:341776
WP_024717584.1|268893_269376_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_016484410.1|269485_269887_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_016484411.1|270001_270796_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_095116611.1|270917_271817_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_060518076.1|271996_273538_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	46.7	5.6e-125
WP_016484414.1|273750_274191_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_016484415.1|274245_274725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096425462.1|274921_277267_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_070086869.1|277272_278103_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_016484418.1|278280_278721_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	47.5	4.3e-06
WP_095116612.1|278833_279496_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_016484420.1|279560_280127_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_096425463.1|280123_280942_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016484422.1|281019_281475_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096425464.1|281474_282881_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	28.7	6.6e-08
WP_016484424.1|282877_284692_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016484425.1|284734_285280_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.4	3.0e-49
WP_095116614.1|285558_286665_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.8	5.6e-103
WP_016484427.1|286848_287046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016484428.1|287179_289255_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016484429.1|289730_291050_+	OprD family porin	NA	NA	NA	NA	NA
WP_016484430.1|291080_292748_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_096426925.1|292978_294346_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_096425465.1|294347_295070_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.1e-30
WP_096425466.1|295210_297508_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_024717587.1|297632_297839_-	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_102668038.1|297890_298100_-	Abi family protein	NA	NA	NA	NA	NA
WP_096425467.1|298269_299880_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_157754387.1|300530_301208_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_139137840.1|301200_302025_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_054888396.1|302017_303085_+	beta family protein	NA	NA	NA	NA	NA
WP_139137841.1|303065_303632_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_054888398.1|304330_305311_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_054888399.1|306241_307561_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	34.2	1.2e-64
307724:307771	attL	TGGTGCCGGCACCAGGAATCGAACCCGGGACCTACTGATTACAAGTCA	NA	NA	NA	NA
WP_029885337.1|307866_309039_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.4	6.4e-73
WP_029885335.1|309477_309708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172901721.1|309704_309878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029885333.1|310519_310813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029885332.1|310826_313625_-	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	63.2	0.0e+00
WP_029885331.1|313636_313879_-	hypothetical protein	NA	A0A2H4JGL7	uncultured_Caudovirales_phage	53.8	2.0e-13
WP_029885330.1|313956_314325_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	33.3	2.5e-07
WP_029885329.1|314321_314624_-	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	44.1	2.5e-13
WP_029885328.1|314620_315106_-	hypothetical protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	56.5	3.4e-44
WP_029885327.1|315136_315337_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_029885326.1|315413_315746_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	48.1	8.0e-21
WP_029885325.1|315826_316297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029885324.1|316580_317846_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	70.8	3.8e-164
WP_029885323.1|317842_318283_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	72.6	1.8e-57
WP_050492178.1|318289_322006_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	44.9	5.0e-87
WP_016484463.1|321995_322115_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	71.8	3.2e-09
WP_029885321.1|322123_322462_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	57.9	1.8e-20
WP_029885320.1|322482_322998_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	71.3	7.9e-68
WP_029885319.1|323012_324185_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	74.6	4.0e-168
WP_029885318.1|324286_324748_-	hypothetical protein	NA	A0A077K9S5	Ralstonia_phage	50.8	1.3e-21
WP_029885317.1|324770_325511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029885316.1|325517_326396_-|tail	phage tail protein	tail	A2I2X8	Vibrio_virus	39.4	1.5e-21
WP_029885315.1|326392_327205_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	28.3	2.8e-11
WP_029885314.1|327201_328200_-|plate	baseplate J/gp47 family protein	plate	E5G6N8	Salmonella_phage	43.7	1.9e-62
WP_029885313.1|328211_328556_-	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	54.0	3.5e-27
WP_029885312.1|328552_329128_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	63.5	2.0e-64
WP_029885311.1|329188_329644_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	58.8	6.2e-40
WP_029885310.1|329636_330170_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	59.8	7.5e-53
WP_029885309.1|330244_330718_-|lysis	phage lysis regulatory protein, LysB family	lysis	Q9ZXL5	Pseudomonas_virus	41.6	1.0e-16
WP_029885308.1|330714_330924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029885307.1|330920_331760_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	61.9	3.9e-88
WP_016484478.1|331756_332074_-|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	52.4	3.7e-23
WP_029885306.1|332107_332320_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	74.2	3.3e-20
WP_029885305.1|332319_332796_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	61.4	3.5e-46
WP_029885304.1|332893_333595_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	58.8	5.5e-64
WP_029885303.1|333598_334669_-|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	72.5	2.0e-137
WP_029885302.1|334702_335551_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	59.9	2.6e-84
WP_029885301.1|335703_337455_+|terminase	terminase ATPase subunit family protein	terminase	A0A2H4JGK4	uncultured_Caudovirales_phage	79.9	1.4e-270
WP_050492177.1|337454_338498_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	77.6	7.8e-155
WP_029885299.1|338600_339410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029885298.1|339574_339811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096425468.1|339819_340059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033744332.1|340204_341002_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	57.3	2.4e-23
WP_060518051.1|341902_342151_-	hypothetical protein	NA	NA	NA	NA	NA
341729:341776	attR	TGGTGCCGGCACCAGGAATCGAACCCGGGACCTACTGATTACAAGTCA	NA	NA	NA	NA
WP_016484491.1|342717_342987_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_096425469.1|343262_344468_-	methyltransferase	NA	NA	NA	NA	NA
WP_016497592.1|344595_345285_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016497593.1|345284_345977_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016484495.1|346031_346784_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016484496.1|346795_347569_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	8.4e-21
WP_016484497.1|348208_349594_+	GABA permease	NA	NA	NA	NA	NA
WP_016484498.1|349773_350217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016484499.1|350348_350885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161775548.1|350890_351763_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_016484501.1|352207_352480_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016484502.1|352476_353544_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_070086619.1|353540_355787_-	AsmA family protein	NA	NA	NA	NA	NA
WP_016484504.1|356171_357833_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023532883.1|358052_358646_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_016484506.1|358646_359285_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_016484507.1|359285_359546_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_016484508.1|359573_360311_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_008091498.1|360321_361092_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_016484509.1|361209_362388_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.7	1.1e-24
WP_169725175.1|362384_363233_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_016484511.1|363314_364262_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_016484512.1|364715_366092_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016484513.1|366585_367692_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016484514.1|367855_368113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096425470.1|368383_368854_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_096425471.1|368864_369830_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_016484517.1|369848_370733_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_096425472.1|370856_371801_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 2
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	1204585	1212365	6583377		Thermobifida_phage(16.67%)	10	NA	NA
WP_016485035.1|1204585_1205440_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.0	1.2e-07
WP_016485036.1|1205442_1205907_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_016485037.1|1205919_1206228_-	ribosome-associated translation inhibitor RaiA	NA	A0A0M7QCF2	Escherichia_phage	34.1	4.4e-05
WP_024717623.1|1206307_1207801_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003255132.1|1207978_1208704_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.4e-23
WP_096425615.1|1208704_1209229_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016485040.1|1209215_1209788_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_023046949.1|1209796_1210321_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	48.1	9.0e-27
WP_016485042.1|1210332_1211307_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	1.3e-34
WP_016485043.1|1211555_1212365_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-25
>prophage 3
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	1429990	1488684	6583377	tRNA,transposase,protease	Cafeteria_roenbergensis_virus(11.11%)	50	NA	NA
WP_016485213.1|1429990_1431343_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_096425675.1|1431416_1433777_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_012270843.1|1433821_1434325_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_016485215.1|1434326_1435382_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_008094893.1|1435496_1435937_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016485216.1|1435933_1436710_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_096425676.1|1436711_1437839_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_023048359.1|1437840_1438464_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.0	4.7e-22
WP_016485219.1|1438674_1442199_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	36.2	4.6e-191
WP_024717683.1|1442306_1443254_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_096425677.1|1443386_1444670_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016485222.1|1444940_1446569_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_012270852.1|1446572_1447418_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.0	8.5e-51
WP_016485223.1|1447571_1448861_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	1.6e-138
WP_016485224.1|1449029_1449311_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_095117280.1|1449307_1450015_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_023048356.1|1450049_1450946_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016485227.1|1451053_1452166_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.5	8.0e-33
WP_096425678.1|1452174_1453029_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016485229.1|1453205_1453679_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_096425679.1|1453675_1454734_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016485231.1|1454721_1455471_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.2	1.7e-66
WP_015269209.1|1455506_1456145_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	1.7e-40
WP_016485232.1|1456384_1457242_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
WP_003252351.1|1457350_1458358_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
WP_016485233.1|1458940_1459264_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_060519606.1|1459404_1461978_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.4	6.9e-27
WP_023047667.1|1462165_1463233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016485236.1|1463287_1463770_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.7	3.1e-58
WP_096425680.1|1464495_1465539_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.2	1.9e-108
WP_096425681.1|1465909_1467289_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_034018616.1|1467581_1468964_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_096425682.1|1469117_1470146_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	2.1e-43
WP_096425683.1|1470326_1471691_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_096425684.1|1471687_1472176_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_096425685.1|1472278_1473289_+	ring-hydroxylating dioxygenase ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_096425686.1|1473431_1474196_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_096425687.1|1474708_1475035_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_096426936.1|1476846_1478069_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	70.3	1.2e-111
WP_096425688.1|1477975_1478998_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_096425689.1|1479244_1480459_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_090313850.1|1480549_1481410_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_096425690.1|1481425_1482463_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_096425691.1|1482462_1483221_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	26.6	6.3e-13
WP_096426937.1|1483238_1483970_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.1	2.5e-14
WP_096425692.1|1484164_1485109_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096425693.1|1485336_1485651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004423344.1|1486392_1486683_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004423345.1|1486679_1487024_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	33.7	1.1e-12
WP_011911868.1|1487145_1488684_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	2220880	2282752	6583377	coat,protease	Bacillus_virus(10.0%)	56	NA	NA
WP_016485885.1|2220880_2222164_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	8.1e-138
WP_060518931.1|2222327_2224724_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	5.7e-217
WP_016485887.1|2224876_2225149_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	64.0	7.7e-22
WP_096425867.1|2225330_2227202_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016485889.1|2227326_2228367_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_003250254.1|2228545_2228824_+	lipoprotein	NA	NA	NA	NA	NA
WP_024717591.1|2228838_2229606_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_016485890.1|2229694_2230492_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_016485891.1|2230628_2230997_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_016485892.1|2231072_2232551_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	7.9e-28
WP_016485893.1|2232660_2233458_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016485894.1|2233615_2235022_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016485895.1|2235233_2235542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096425868.1|2235553_2236027_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_096425869.1|2236091_2238599_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016485898.1|2238598_2239282_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.1e-35
WP_016485899.1|2239292_2239898_+	arylesterase	NA	NA	NA	NA	NA
WP_016485900.1|2239956_2240247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016485901.1|2240360_2241338_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003259780.1|2241470_2241722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003250290.1|2242230_2242512_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_016485902.1|2242647_2243724_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.5	6.3e-83
WP_060518840.1|2243957_2244905_+	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_016485904.1|2245040_2245538_+	universal stress protein	NA	NA	NA	NA	NA
WP_016485905.1|2245666_2246641_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_016500538.1|2246680_2247415_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_016485907.1|2247494_2248838_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	32.7	4.5e-46
WP_060518838.1|2249046_2250027_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016485909.1|2250026_2251562_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016485910.1|2251567_2252104_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_016485911.1|2252410_2253127_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016485912.1|2253123_2254014_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_016485913.1|2254072_2255200_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_016485914.1|2255393_2257982_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_070086792.1|2258132_2259323_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_016485916.1|2259395_2260880_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_016485917.1|2260954_2263564_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_161775554.1|2263970_2264453_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_012271598.1|2264463_2264820_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_016485919.1|2264873_2265953_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016485920.1|2266146_2266455_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_016485921.1|2266454_2266769_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_016485922.1|2266769_2267438_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016485923.1|2267434_2268754_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_095114807.1|2269024_2270179_+	HPP family protein	NA	NA	NA	NA	NA
WP_023049247.1|2270152_2271019_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070086769.1|2271197_2273087_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	29.3	6.3e-54
WP_096425870.1|2273212_2274283_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016485928.1|2274410_2274653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023048722.1|2275204_2277592_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.4	5.1e-08
WP_016485929.1|2277605_2278067_-	response regulator	NA	NA	NA	NA	NA
WP_096425871.1|2278082_2280329_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	24.2	3.6e-24
WP_016485931.1|2280598_2281126_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_096425872.1|2281156_2281693_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016485933.1|2281711_2282245_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016485934.1|2282248_2282752_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	3799855	3845729	6583377	terminase,integrase,transposase	Pseudomonas_phage(64.0%)	66	3837916:3837930	3851187:3851201
WP_096426270.1|3799855_3802120_-	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	59.6	2.9e-05
WP_096426271.1|3802176_3805230_-	hypothetical protein	NA	B5WZT8	Pseudomonas_phage	40.1	3.3e-214
WP_020193253.1|3805226_3805604_-	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	43.3	6.1e-25
WP_096426272.1|3805606_3806086_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	42.0	5.9e-25
WP_095114787.1|3806082_3806535_-|transposase	transposase	transposase	A0A2H4PI05	Pseudomonas_phage	27.0	3.5e-11
WP_096426273.1|3806714_3810746_-	tape measure protein	NA	A0A059VJZ1	Pseudomonas_phage	28.6	1.1e-39
WP_096426275.1|3811057_3811582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426276.1|3811639_3812809_-	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	38.1	1.5e-53
WP_096426277.1|3812870_3813275_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_096426278.1|3813271_3813661_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	50.4	6.5e-30
WP_096426279.1|3813663_3814047_-	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	49.2	7.3e-26
WP_096426280.1|3814048_3814420_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	58.3	7.3e-31
WP_096426281.1|3814419_3814713_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	52.9	1.4e-05
WP_096426282.1|3814754_3815723_-	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	79.8	2.4e-142
WP_096426283.1|3815732_3816479_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	81.7	9.0e-105
WP_096426284.1|3816630_3817707_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	51.2	1.3e-96
WP_172901740.1|3817706_3819086_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	65.0	2.0e-174
WP_096426286.1|3819088_3820369_-|terminase	terminase	terminase	A0A2H4IY82	uncultured_Caudovirales_phage	82.9	2.2e-204
WP_096426287.1|3820343_3821093_-|terminase	terminase small subunit	terminase	A0A248SKT2	Klebsiella_phage	50.9	9.2e-57
WP_064492775.1|3821131_3821572_-	hypothetical protein	NA	A0A2H4J821	uncultured_Caudovirales_phage	60.7	3.9e-39
WP_172901741.1|3821568_3821733_-	hypothetical protein	NA	A0A2H4J789	uncultured_Caudovirales_phage	72.2	1.5e-17
WP_096426288.1|3821743_3821974_-	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	62.0	2.8e-17
WP_096426289.1|3822029_3822299_-	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	56.5	1.3e-16
WP_096426290.1|3822298_3822610_-	peptidase M48, Ste24p	NA	A0A1B0VME9	Pseudomonas_phage	49.5	3.2e-16
WP_096426291.1|3822784_3823294_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	98.2	1.1e-85
WP_096426292.1|3823521_3824208_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	50.2	7.9e-55
WP_172901742.1|3824204_3824354_-	hypothetical protein	NA	A0A2H4J3D6	uncultured_Caudovirales_phage	68.8	2.8e-10
WP_096426293.1|3824350_3824710_-	endodeoxyribonuclease RusA	NA	NA	NA	NA	NA
WP_096426294.1|3824706_3825009_-	DUF1364 family protein	NA	A0A2K8HR56	Pseudomonas_phage	51.0	3.8e-22
WP_096426295.1|3825005_3825593_-	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	86.2	4.9e-98
WP_096426296.1|3825585_3825864_-	hypothetical protein	NA	A0A2H4J8S0	uncultured_Caudovirales_phage	58.2	7.4e-20
WP_096426297.1|3825860_3826205_-	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	100.0	6.3e-29
WP_096426298.1|3826204_3826396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426299.1|3826395_3827202_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	53.4	7.8e-62
WP_054881787.1|3827188_3828172_-	hypothetical protein	NA	A0A1B0VME0	Pseudomonas_phage	71.6	2.6e-112
WP_157754407.1|3828589_3828739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426300.1|3828735_3829551_-	Rha family transcriptional regulator	NA	Q8W644	Enterobacteria_phage	53.3	2.2e-40
WP_096426301.1|3829680_3829890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426302.1|3829910_3830117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084966458.1|3830377_3830566_-	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	62.9	1.2e-13
WP_172901763.1|3830598_3830796_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	53.8	2.0e-11
WP_096426967.1|3830924_3831635_+	helix-turn-helix domain-containing protein	NA	W6MVG5	Pseudomonas_phage	59.8	6.6e-73
WP_096426304.1|3831665_3831974_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_096426305.1|3832398_3833043_+	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	80.4	4.4e-100
WP_096426306.1|3833747_3834161_+	hypothetical protein	NA	W6MVG2	Pseudomonas_phage	54.1	7.1e-35
WP_096426307.1|3834182_3834437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426308.1|3834433_3834664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426309.1|3834660_3834855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426310.1|3835013_3835322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157754409.1|3835318_3835465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049696254.1|3835473_3836106_+	AAA family ATPase	NA	A0A059VF62	Pseudomonas_phage	72.6	2.6e-84
WP_096426311.1|3836117_3836774_+	hypothetical protein	NA	A0A059VFZ1	Pseudomonas_phage	72.6	7.7e-84
WP_096426312.1|3836835_3837501_+	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	71.3	1.0e-91
WP_096426313.1|3837504_3837693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426314.1|3837774_3838140_+	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	89.3	1.1e-55
3837916:3837930	attL	GACAGCGCCGATCAC	NA	NA	NA	NA
WP_096426315.1|3838114_3838474_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	44.8	3.9e-13
WP_016487804.1|3838553_3838934_+	hypothetical protein	NA	A0A2H4J2C6	uncultured_Caudovirales_phage	55.1	5.0e-35
WP_172901743.1|3838980_3839691_+	Lar family restriction alleviation protein	NA	K4NZ01	Pseudomonas_phage	32.4	1.2e-05
WP_096426318.1|3840434_3840929_+	hypothetical protein	NA	I2GUG5	Acinetobacter_phage	32.7	2.7e-09
WP_096426319.1|3840925_3841177_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	95.2	2.9e-39
WP_096426968.1|3841221_3841548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426320.1|3841544_3842006_+	DUF2591 domain-containing protein	NA	A0A1B0VMD7	Pseudomonas_phage	33.8	3.6e-11
WP_096426321.1|3841993_3842326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172901744.1|3842322_3842499_+	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	93.1	3.3e-26
WP_046787169.1|3842788_3843967_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.1	7.0e-160
WP_096426322.1|3844271_3845729_+|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	38.6	4.6e-52
3851187:3851201	attR	GTGATCGGCGCTGTC	NA	NA	NA	NA
>prophage 6
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	4109970	4176013	6583377	tRNA,terminase,protease,tail,capsid,portal,integrase,head	Pseudomonas_phage(43.48%)	78	4112524:4112538	4177608:4177622
WP_060517119.1|4109970_4110384_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016488005.1|4110791_4111034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016488006.1|4111055_4111325_+	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_096426450.1|4111424_4112345_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
4112524:4112538	attL	CCCTTTCCCCAGAGC	NA	NA	NA	NA
WP_080641109.1|4112552_4113365_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_096426451.1|4113361_4114141_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096426452.1|4114179_4115490_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.3	2.7e-43
WP_016488012.1|4115858_4116107_-	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
WP_096426453.1|4116467_4116731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426454.1|4116916_4117222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426456.1|4117586_4117811_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	81.1	1.3e-27
WP_096426457.1|4117947_4119003_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	30.2	3.6e-22
WP_096426458.1|4119098_4119596_-	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	56.4	1.1e-34
WP_096426459.1|4119592_4120024_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	75.7	4.6e-53
WP_020190400.1|4120114_4121374_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_172901747.1|4121965_4122136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426460.1|4122119_4122500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426461.1|4122496_4131037_-|tail	phage tail protein	tail	A0A2H4J8Z6	uncultured_Caudovirales_phage	66.0	0.0e+00
WP_096426462.1|4131093_4131681_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	72.3	2.1e-72
WP_096426463.1|4131731_4132076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426464.1|4132106_4132862_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	76.9	2.6e-120
WP_096426465.1|4132864_4133614_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	78.7	1.3e-122
WP_096426466.1|4133610_4133949_-|tail	phage tail protein	tail	A0A1S5R1J0	Pseudomonas_phage	37.5	8.7e-15
WP_096426467.1|4133948_4137239_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	32.9	2.4e-69
WP_070086811.1|4137284_4137521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020190152.1|4137517_4137862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426468.1|4137902_4138403_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	75.8	7.7e-68
WP_086975829.1|4138458_4138845_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	84.4	6.8e-56
WP_086975827.1|4138837_4139413_-	HK97 gp10 family phage protein	NA	A0A2D1GNN2	Pseudomonas_phage	56.3	6.2e-53
WP_020190149.1|4139416_4139587_-	hypothetical protein	NA	A0A2D1GNQ5	Pseudomonas_phage	53.7	1.4e-05
WP_080574875.1|4139595_4139922_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JC00	uncultured_Caudovirales_phage	49.1	1.1e-19
WP_096426469.1|4139918_4140260_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	33.0	2.0e-06
WP_157754415.1|4140264_4140810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016485706.1|4140858_4142040_-|capsid	phage major capsid protein	capsid	A0A218MGA4	Pseudomonas_phage	60.9	3.7e-121
WP_096426470.1|4142042_4142900_-|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	64.3	5.5e-98
WP_096426471.1|4142916_4144215_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	72.4	4.3e-187
WP_096426473.1|4144365_4146045_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	60.2	7.5e-192
WP_027609640.1|4146048_4146525_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	46.5	3.9e-21
WP_096426474.1|4146764_4147100_-	HNH endonuclease	NA	A8B112	Xanthomonas_virus	47.3	5.2e-20
WP_172901748.1|4147099_4147258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426476.1|4147494_4147911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426477.1|4147938_4148157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426478.1|4148153_4148345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426479.1|4148341_4148671_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	56.7	3.6e-13
WP_054912146.1|4148677_4149040_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	80.6	4.3e-36
WP_096426480.1|4149039_4149237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426481.1|4149603_4150290_-	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	63.6	1.0e-78
WP_157754417.1|4150395_4150800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426483.1|4150796_4152086_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	51.8	3.0e-116
WP_096426484.1|4152082_4152511_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	68.5	1.2e-48
WP_096426485.1|4152507_4152756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426486.1|4152752_4153052_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	66.0	1.9e-29
WP_096426487.1|4153054_4153849_-	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	54.5	4.6e-75
WP_096426488.1|4153838_4154705_-	replication protein	NA	W6MYB0	Pseudomonas_phage	40.7	8.2e-41
WP_096426489.1|4154843_4155068_-	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	46.2	1.8e-08
WP_096426490.1|4155172_4155979_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH0	Pseudomonas_phage	52.9	1.6e-70
WP_096426492.1|4156338_4158339_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096426493.1|4158558_4159107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426495.1|4159533_4159860_-	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	65.7	1.0e-28
WP_096426496.1|4160854_4161238_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	52.9	8.3e-22
WP_096426497.1|4161255_4161588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426498.1|4161584_4162082_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	69.2	3.1e-45
WP_172901749.1|4162084_4162246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426499.1|4162334_4162682_+	hypothetical protein	NA	I3PUY8	Vibrio_phage	50.0	8.1e-24
WP_096426500.1|4162708_4163524_+	DUF2303 family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	41.4	1.1e-47
WP_096426501.1|4164026_4164788_+	hypothetical protein	NA	A0A2H4J7T1	uncultured_Caudovirales_phage	91.3	1.6e-133
WP_096426503.1|4165144_4167037_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	36.0	5.3e-101
WP_096426505.1|4168538_4169198_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	42.7	6.4e-38
WP_096426506.1|4169194_4169461_+	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	72.7	1.6e-27
WP_096426507.1|4169457_4169757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426508.1|4169753_4170137_+	DUF2591 domain-containing protein	NA	A0A125RNP6	Pseudomonas_phage	41.7	4.0e-16
WP_096426509.1|4170133_4170328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426510.1|4170344_4170530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096426981.1|4170620_4171523_+	phosphohydrolase	NA	A0A1V0E8C5	Vibrio_phage	45.8	5.3e-67
WP_096426511.1|4171576_4172074_+	hypothetical protein	NA	A0A1B0VM52	Pseudomonas_phage	59.8	3.2e-34
WP_085614919.1|4172112_4172358_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_096426512.1|4172359_4173421_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.8	1.5e-105
WP_096426982.1|4174606_4176013_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4177608:4177622	attR	GCTCTGGGGAAAGGG	NA	NA	NA	NA
>prophage 7
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	4248638	4259614	6583377	tRNA	uncultured_Caudovirales_phage(77.78%)	13	NA	NA
WP_063422635.1|4248638_4249103_-	hypothetical protein	NA	A0A2H4J163	uncultured_Caudovirales_phage	41.2	6.5e-29
WP_063422634.1|4249151_4249547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063422633.1|4249675_4250137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003251184.1|4250815_4251487_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.0	2.1e-105
WP_023047266.1|4251808_4253188_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.6e-27
WP_016488109.1|4253363_4253756_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.1	2.5e-53
WP_096426520.1|4253757_4254117_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	1.6e-35
WP_016488111.1|4254116_4254413_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	61.6	2.8e-25
WP_016488112.1|4254409_4254745_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	1.3e-42
WP_024717418.1|4254756_4255758_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	82.0	2.1e-157
WP_096426521.1|4255852_4256812_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_016488115.1|4256941_4258333_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_016488116.1|4258333_4259614_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.1	5.9e-96
>prophage 8
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	5699704	5707688	6583377	transposase	uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_053870531.1|5699704_5701192_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	98.6	1.1e-266
WP_024947943.1|5701203_5702055_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	94.7	4.6e-145
WP_024947944.1|5702146_5702680_+	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	96.2	1.4e-67
WP_009684098.1|5702713_5704249_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	45.9	1.6e-116
WP_009684097.1|5704310_5704646_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_009684096.1|5704642_5704975_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_096426773.1|5705238_5705568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096426774.1|5705639_5706608_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	44.4	1.7e-63
WP_096426775.1|5706683_5707688_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	45.4	3.1e-44
>prophage 9
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	5928830	5939128	6583377		Agrobacterium_phage(16.67%)	7	NA	NA
WP_016489424.1|5928830_5930036_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	35.6	3.0e-49
WP_016489425.1|5930039_5930867_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	47.0	7.8e-49
WP_024717363.1|5930981_5931431_-	azurin	NA	NA	NA	NA	NA
WP_096426843.1|5931780_5932368_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	24.4	3.1e-07
WP_096426844.1|5932496_5934797_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	94.6	7.5e-134
WP_096426845.1|5935954_5937559_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.7	3.0e-12
WP_023046912.1|5937730_5939128_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	57.3	2.9e-141
>prophage 10
NZ_AP015029	Pseudomonas putida strain KF715 chromosome 1	6583377	6529410	6538490	6583377		uncultured_Caudovirales_phage(75.0%)	10	NA	NA
WP_016489886.1|6529410_6530595_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.2	4.9e-36
WP_016489887.1|6530803_6532204_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	3.2e-47
WP_023048556.1|6532820_6533270_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049695271.1|6533447_6533804_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.8	7.0e-39
WP_049695270.1|6533833_6535117_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	85.2	5.2e-201
WP_023048558.1|6535131_6535602_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	82.7	2.1e-67
WP_023048559.1|6535625_6536339_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	89.5	1.8e-118
WP_080992800.1|6536343_6536847_+	dual specificity protein phosphatase family protein	NA	NA	NA	NA	NA
WP_023048561.1|6536872_6537955_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	66.1	5.3e-106
WP_023048562.1|6537947_6538490_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	68.4	5.1e-57
>prophage 1
NZ_AP015030	Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence	483376	271797	282538	483376		Morganella_phage(20.0%)	14	NA	NA
WP_062378614.1|271797_273084_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	45.8	9.1e-97
WP_011005854.1|273073_273505_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	40.5	5.3e-17
WP_062378615.1|273642_274593_+	hypothetical protein	NA	A0A068CDF3	Rhizobium_phage	38.1	1.9e-51
WP_011005856.1|274623_274899_+	hypothetical protein	NA	A0A2H4J6R2	uncultured_Caudovirales_phage	40.5	7.3e-12
WP_011005860.1|276267_276492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011005861.1|276532_276835_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	46.4	8.0e-12
WP_011005862.1|276831_277134_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	51.6	1.2e-20
WP_011005863.1|277335_278115_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_011005864.1|278268_278637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062378618.1|278669_278987_+	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.6	6.5e-12
WP_011005866.1|279042_279261_+	hypothetical protein	NA	A0A2I6PI24	Pseudomonas_phage	51.0	6.2e-06
WP_062378625.1|279399_280419_+	hypothetical protein	NA	G9BWC3	Planktothrix_phage	30.0	7.9e-19
WP_011005868.1|280561_280804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062378620.1|280855_282538_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	70.0	2.3e-193
>prophage 1
NZ_AP015032	Pseudomonas putida strain KF715 plasmid pKF715C, complete sequence	94696	66710	77112	94696	terminase	Pseudomonas_phage(55.56%)	12	NA	NA
WP_157754477.1|66710_67472_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	37.1	2.6e-27
WP_157754478.1|68275_68968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096427271.1|69375_69738_-	DUF1064 domain-containing protein	NA	A0A248SL54	Klebsiella_phage	64.7	1.6e-30
WP_096427227.1|69908_70181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427228.1|70177_70435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427229.1|70434_72213_-	DEAD/DEAH box helicase	NA	A0A2K8IBK8	Pseudomonas_phage	77.4	1.3e-274
WP_096427272.1|72209_72575_-	hypothetical protein	NA	A0A0U1UNQ6	Pseudomonas_phage	65.3	3.3e-36
WP_096427230.1|72736_73732_-	hypothetical protein	NA	A0A218L3S6	Pseudomonas_phage	27.9	8.3e-13
WP_096427231.1|73728_74466_-	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	43.7	1.5e-06
WP_096427232.1|74458_74995_-	DUF1382 family protein	NA	W6MW43	Pseudomonas_phage	44.6	7.6e-05
WP_096427233.1|74991_76683_-	hypothetical protein	NA	A0A2H4J7T1	uncultured_Caudovirales_phage	35.2	2.6e-27
WP_096427273.1|76746_77112_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	56.4	1.1e-07
>prophage 2
NZ_AP015032	Pseudomonas putida strain KF715 plasmid pKF715C, complete sequence	94696	83041	93451	94696		Pseudomonas_virus(20.0%)	17	NA	NA
WP_096427249.1|83041_83536_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	59.8	4.8e-46
WP_172901777.1|83532_83841_-	hypothetical protein	NA	A0A1B1P7B7	Bacillus_phage	34.5	9.7e-05
WP_096427251.1|84941_85571_-	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	37.3	2.0e-25
WP_096427252.1|85567_85984_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_096427253.1|85971_86403_-	hypothetical protein	NA	R9TRR2	Rhizobium_phage	44.9	3.1e-25
WP_096427254.1|86399_87017_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	33.9	2.4e-18
WP_096427255.1|87055_87352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427256.1|87341_87701_-	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	40.8	2.4e-15
WP_157754479.1|87697_88345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427258.1|88334_88628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427259.1|88624_88981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427260.1|89182_89587_-	recombinase	NA	A0A222YXV2	Escherichia_phage	35.7	2.1e-07
WP_096427261.1|89583_90732_-	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	43.6	4.7e-12
WP_096427262.1|91184_91661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096427263.1|91813_92341_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	70.1	2.8e-44
WP_096427264.1|92344_92527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096427265.1|92530_93451_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	64.7	2.4e-107
