The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	11350	62737	3767292	transposase,integrase	Enterobacteria_phage(50.0%)	48	57460:57475	69564:69579
WP_096362064.1|11350_12613_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	32.7	1.3e-39
WP_066522470.1|12609_13470_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.0	4.0e-56
WP_096362065.1|13720_15235_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_083949276.1|15435_15615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905411.1|16119_16938_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_083949247.1|16934_17894_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_123905412.1|18126_20445_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066522084.1|20521_21301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083949245.1|21316_22429_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_169925546.1|22629_23760_+	cytochrome P450	NA	NA	NA	NA	NA
WP_083949256.1|24741_25506_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	3.8e-18
WP_066522187.1|25578_25869_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_083949254.1|27032_27833_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_066522184.1|27877_28687_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_169800599.1|28944_29439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522183.1|29473_29947_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_066522177.1|30084_30729_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_066522166.1|30725_31112_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_096362067.1|31264_31543_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_066522512.1|31632_32469_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096362187.1|32489_32780_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	46.2	2.2e-14
WP_123905416.1|32895_33162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083949228.1|33158_33437_-	DUF3325 family protein	NA	NA	NA	NA	NA
WP_066521913.1|33433_33736_-	iron transporter	NA	NA	NA	NA	NA
WP_066521915.1|33732_35364_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_066521917.1|35433_37686_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_066521919.1|37986_38502_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066521924.1|38638_39604_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_066521929.1|39745_42196_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_083949230.1|42253_43345_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_083949231.1|43341_44145_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_096362068.1|44291_45251_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_169800587.1|45649_46252_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_066521579.1|46339_47569_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_066521581.1|47591_48791_-	MFS transporter	NA	NA	NA	NA	NA
WP_066521583.1|48794_50438_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_066521587.1|50434_52489_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_066521589.1|52672_54919_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083949215.1|54962_56246_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_066521598.1|56257_56629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066521600.1|56640_57810_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
57460:57475	attL	CAATATGGTGGCCTGG	NA	NA	NA	NA
WP_066521602.1|57839_58223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157080340.1|58763_59009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157080341.1|59017_59995_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_066521609.1|60641_60887_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_066521611.1|60883_61270_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_066521616.1|61350_61602_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_066522499.1|61666_62737_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
69564:69579	attR	CCAGGCCACCATATTG	NA	NA	NA	NA
>prophage 2
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	67838	96381	3767292	transposase,integrase	Leptospira_phage(50.0%)	31	59477:59491	98826:98840
59477:59491	attL	ATTGGGCCGGGCGCC	NA	NA	NA	NA
WP_066521675.1|67838_68480_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_096362069.1|68584_69708_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	1.3e-46
WP_169800589.1|69811_70699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157080342.1|70905_71349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157080343.1|71665_71812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521686.1|71837_72101_-	DksA/TraR family C4-type zinc finger protein	NA	A0A173GD24	Pseudomonas_phage	43.7	1.4e-07
WP_066521692.1|72394_72685_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_066521693.1|73172_73427_+	antitoxin	NA	NA	NA	NA	NA
WP_157080344.1|73852_74020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905417.1|74028_75168_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	23.7	9.2e-16
WP_066521696.1|75229_75547_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066521699.1|75543_76794_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_123905418.1|76920_77136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066521701.1|77233_77629_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_066521707.1|77600_77930_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_066521708.1|77993_78275_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_066521710.1|78378_78633_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066522499.1|78689_79760_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_145980659.1|80715_81363_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_066521539.1|81385_82654_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_083949212.1|82902_85389_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066521544.1|86834_87857_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_066521566.1|87872_89102_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_066521546.1|89105_90293_+	CoA transferase	NA	NA	NA	NA	NA
WP_066521548.1|90315_91473_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_083949214.1|91522_91846_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066521554.1|92400_93447_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_066521569.1|94092_94476_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_066521555.1|94621_94873_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_066521556.1|94884_95226_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066521558.1|95472_96381_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.6	2.0e-26
98826:98840	attR	ATTGGGCCGGGCGCC	NA	NA	NA	NA
>prophage 3
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	762593	822877	3767292	tRNA,protease,transposase,integrase	Enterobacteria_phage(25.0%)	50	807119:807166	820263:820310
WP_066515963.1|762593_763613_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_096362088.1|763615_764719_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_066515974.1|764719_766165_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_066515976.1|766263_768519_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.8	1.0e-10
WP_066515978.1|768508_769882_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_066516034.1|770016_770493_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_066515981.1|770533_771865_+	GTPase HflX	NA	NA	NA	NA	NA
WP_066515983.1|771877_772666_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_066515989.1|772774_773785_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066515992.1|773973_775125_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066515994.1|775156_776335_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_096362200.1|776590_777808_+	cytochrome P450	NA	NA	NA	NA	NA
WP_066515999.1|777820_778012_+	ferredoxin	NA	NA	NA	NA	NA
WP_066516036.1|778027_779503_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066516038.1|779513_780794_-	MFS transporter	NA	NA	NA	NA	NA
WP_066516000.1|781237_784237_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.0	2.6e-25
WP_066516003.1|784503_788043_-	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	35.9	3.2e-176
WP_096362089.1|788180_789350_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_066521221.1|789495_790122_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_066521223.1|790127_791153_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_066521226.1|791232_793479_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_083949197.1|793585_796177_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_066521229.1|796169_797648_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_066521253.1|797644_798436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905439.1|798767_799457_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_083949198.1|799453_800122_+	DedA family protein	NA	NA	NA	NA	NA
WP_066521235.1|800126_801218_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_066521237.1|801171_802104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521242.1|802134_802968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521244.1|802964_804296_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_066521259.1|804292_805036_-	nucleoside triphosphate hydrolase	NA	NA	NA	NA	NA
WP_066521266.1|805156_805894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174521990.1|805965_806829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905440.1|806943_807141_+	hypothetical protein	NA	NA	NA	NA	NA
807119:807166	attL	ATGGTGGGCGCGACAGGGATTGAACCTGTGACCCCACCCGTGTGAAGG	NA	NA	NA	NA
WP_083949199.1|807407_808700_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	27.1	3.8e-10
WP_179948862.1|809109_809637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013039223.1|809692_811063_-|transposase	IS1380-like element ISSp1 family transposase	transposase	NA	NA	NA	NA
WP_123905441.1|811173_812157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905442.1|812205_812850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169800604.1|813056_813773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522410.1|813940_814183_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_123905444.1|814343_814619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522470.1|814659_815520_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.0	4.0e-56
WP_096362064.1|815516_816779_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	32.7	1.3e-39
WP_007684572.1|817120_818317_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.0	1.9e-80
WP_169925550.1|818299_819928_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_066513934.1|820474_820603_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
820263:820310	attR	ATGGTGGGCGCGACAGGGATTGAACCTGTGACCCCACCCGTGTGAAGG	NA	NA	NA	NA
WP_066513935.1|820620_820812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169800533.1|820986_821529_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_066514278.1|821575_822877_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.8	7.9e-40
>prophage 4
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	1001364	1050443	3767292	tRNA,protease,transposase,integrase	Bacillus_virus(13.33%)	46	1031749:1031768	1049511:1049530
WP_066514225.1|1001364_1004250_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	24.3	1.4e-60
WP_066514228.1|1004288_1005230_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_066514230.1|1005276_1005777_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	46.0	5.4e-21
WP_066514231.1|1005773_1006844_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_066514233.1|1006845_1007340_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	1.9e-18
WP_066514321.1|1007460_1008147_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_066514235.1|1008302_1010186_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_066514236.1|1010209_1010857_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_066514237.1|1010991_1011537_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.7	3.2e-11
WP_066514239.1|1011577_1012330_-	VIT family protein	NA	NA	NA	NA	NA
WP_066514241.1|1012388_1014170_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.5	1.1e-36
WP_066514243.1|1014310_1015048_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_066514248.1|1015386_1016655_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.7	1.3e-127
WP_066514251.1|1016788_1017424_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.8	1.8e-58
WP_066514324.1|1017517_1018495_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_066514253.1|1018867_1020481_-	trigger factor	NA	NA	NA	NA	NA
WP_066514259.1|1020760_1020958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514261.1|1020973_1021675_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	37.2	8.1e-23
WP_066514263.1|1021760_1022525_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_066514264.1|1022529_1023186_+	endonuclease III	NA	NA	NA	NA	NA
WP_066514326.1|1023284_1023683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514271.1|1024137_1025553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066514273.1|1025549_1026563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096362194.1|1026746_1027475_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.6	1.1e-33
WP_096362065.1|1027461_1028976_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066522486.1|1029088_1030360_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PGY7	Moraxella_phage	24.4	1.2e-16
WP_157080368.1|1030352_1030499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096362092.1|1030495_1032202_-	recombinase family protein	NA	D7RWL2	Brochothrix_phage	23.5	6.2e-16
1031749:1031768	attL	TGGCGCGCAGCACATGCTTG	NA	NA	NA	NA
WP_066521712.1|1032218_1032527_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	40.9	1.9e-08
WP_066521714.1|1032540_1032837_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	47.9	1.5e-18
WP_066521717.1|1032918_1033137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521719.1|1033145_1033358_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_066521722.1|1033526_1033991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157080345.1|1034227_1034899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905447.1|1034980_1035781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905448.1|1036230_1040001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066521730.1|1040069_1040804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083949221.1|1040781_1042227_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_066521731.1|1042226_1044686_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_066521732.1|1044807_1045782_-	FecR family protein	NA	NA	NA	NA	NA
WP_066521734.1|1045890_1046406_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066521736.1|1047169_1047802_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WE94	Clostridium_phage	30.4	6.4e-11
WP_007014453.1|1047919_1048210_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	46.2	9.7e-15
WP_169925551.1|1048199_1048502_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_066522499.1|1048542_1049613_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1049511:1049530	attR	TGGCGCGCAGCACATGCTTG	NA	NA	NA	NA
WP_096362085.1|1049682_1050443_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	1168001	1220720	3767292	tRNA,transposase	Hokovirus(25.0%)	49	NA	NA
WP_066520809.1|1168001_1168424_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_066520807.1|1168477_1168963_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_066520792.1|1169104_1170139_+	RcnB family protein	NA	NA	NA	NA	NA
WP_066520790.1|1170278_1171097_-	arginyltransferase	NA	NA	NA	NA	NA
WP_066520787.1|1171210_1172458_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_066520784.1|1172553_1173423_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066520781.1|1173419_1175111_+	amidohydrolase	NA	NA	NA	NA	NA
WP_066520778.1|1175187_1177083_-	amidotransferase 1, exosortase A system-associated	NA	A0A1V0SGM7	Hokovirus	26.2	1.4e-16
WP_066520775.1|1177163_1178729_-	EpsI domain-containing exosortase	NA	NA	NA	NA	NA
WP_066520772.1|1178725_1179952_-	TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase	NA	NA	NA	NA	NA
WP_066520770.1|1179948_1181019_-	FemAB family PEP-CTERM system-associated protein	NA	NA	NA	NA	NA
WP_174521986.1|1181015_1181864_-	DUF3473 domain-containing protein	NA	NA	NA	NA	NA
WP_066520768.1|1181905_1183108_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066520765.1|1183153_1184773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066520762.1|1184769_1185699_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_066520759.1|1185712_1187233_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_066520756.1|1187234_1187879_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_066520754.1|1188011_1189244_-	pyridoxal-dependent decarboxylase, exosortase A system-associated	NA	NA	NA	NA	NA
WP_066520751.1|1190818_1191826_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066520750.1|1191851_1192142_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_066521832.1|1192310_1193273_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.1	8.1e-66
WP_066521835.1|1193381_1194119_-	peptidase	NA	NA	NA	NA	NA
WP_066521838.1|1194144_1195017_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_066521840.1|1195035_1195968_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_066521843.1|1195972_1197382_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_066521847.1|1197595_1198444_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_083949226.1|1198657_1199380_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_066521852.1|1199475_1199784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521859.1|1199780_1200071_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_066521866.1|1200067_1201627_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_066521868.1|1201662_1204176_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_066521871.1|1204315_1205272_-	FecR family protein	NA	NA	NA	NA	NA
WP_083949225.1|1205356_1205881_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_082734689.1|1206119_1206539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062346440.1|1206535_1206907_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	30.4	1.9e-07
WP_066522435.1|1207201_1208695_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.5	7.9e-92
WP_066522462.1|1209221_1209803_-	YceI family protein	NA	NA	NA	NA	NA
WP_066522461.1|1209807_1210398_-	cytochrome b	NA	NA	NA	NA	NA
WP_096362206.1|1210501_1211023_-	YceI family protein	NA	NA	NA	NA	NA
WP_169925553.1|1211023_1211746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066522384.1|1211993_1214018_+	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_145980665.1|1214291_1214690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169925554.1|1215540_1215684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037487140.1|1216094_1217126_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_123905450.1|1217212_1217979_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_123905451.1|1218039_1218450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905452.1|1218536_1218905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096362207.1|1219112_1219873_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096362085.1|1219959_1220720_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	1966727	1995546	3767292	head,transposase,capsid	Rhodobacter_phage(25.0%)	40	NA	NA
WP_066517752.1|1966727_1967570_-	hypothetical protein	NA	R9TH35	Synechococcus_phage	43.0	1.8e-13
WP_123905472.1|1967569_1968610_-	hypothetical protein	NA	R9TJ58	Synechococcus_phage	26.4	2.2e-32
WP_066517746.1|1968606_1972320_-	hypothetical protein	NA	R9TF76	Synechococcus_phage	32.2	3.2e-25
WP_169800560.1|1972327_1972537_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_066517742.1|1972680_1973010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517735.1|1973124_1974084_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	47.4	6.9e-73
WP_066517732.1|1974084_1974309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517729.1|1974311_1974755_-	hypothetical protein	NA	A0A1B0T6E9	Thiobacimonas_phage	40.5	1.4e-20
WP_066517727.1|1974768_1975197_-	DUF1320 domain-containing protein	NA	M4SPQ8	Rhodobacter_phage	54.2	2.3e-36
WP_123905473.1|1975193_1975526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517714.1|1975699_1976668_-|capsid	capsid protein	capsid	A0A219VH83	Ochrobactrum_phage	48.1	1.4e-81
WP_066517712.1|1976680_1977049_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_066517711.1|1977045_1978131_-	hypothetical protein	NA	M4SNT6	Rhodobacter_phage	43.2	6.6e-56
WP_066517710.1|1978271_1978787_-	phage virion morphogenesis protein	NA	M4ST99	Rhodobacter_phage	39.5	1.5e-21
WP_066517706.1|1978872_1980132_-|head	phage head protein	head	M4SNU0	Rhodobacter_phage	47.7	4.3e-107
WP_066517701.1|1980222_1981788_-	DUF935 domain-containing protein	NA	M4SPR8	Rhodobacter_phage	55.2	3.1e-163
WP_083949092.1|1981921_1983634_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	59.5	1.0e-175
WP_066517697.1|1983678_1984032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517693.1|1984028_1984340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517690.1|1984354_1984939_-	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	35.0	7.7e-19
WP_066517687.1|1984935_1985130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517686.1|1985126_1985384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517685.1|1985376_1985673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169800559.1|1985669_1985984_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_066517675.1|1986030_1986651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517673.1|1986647_1987196_-	lysozyme	NA	F1ADS8	Caulobacter_phage	43.0	5.0e-20
WP_066517671.1|1987296_1987662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157080313.1|1987661_1987820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517669.1|1987816_1988533_-	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	26.2	4.6e-13
WP_066517666.1|1988534_1988927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169800558.1|1988923_1989079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517664.1|1989087_1990050_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	25.1	1.5e-19
WP_066517662.1|1990065_1992054_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B1P6Z4	Rhodovulum_phage	42.5	4.5e-135
WP_066517659.1|1992050_1992512_-	hypothetical protein	NA	I6P8D5	Pseudomonas_phage	32.2	3.7e-08
WP_066517657.1|1992504_1992732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517656.1|1992731_1992971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083949087.1|1992967_1993567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905474.1|1993563_1994283_-	hypothetical protein	NA	A0A1P8VVC3	Erythrobacter_phage	32.0	1.9e-14
WP_066517648.1|1994476_1994902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066517646.1|1994898_1995546_-	HNH endonuclease	NA	X2KPF7	Streptococcus_phage	34.2	2.6e-15
>prophage 7
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	2727063	2782615	3767292	transposase,integrase	uncultured_Mediterranean_phage(27.27%)	44	2751745:2751796	2782794:2782845
WP_066518756.1|2727063_2728395_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	42.7	1.7e-82
WP_096362142.1|2728394_2728817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066518752.1|2728873_2729134_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_123905512.1|2729145_2730621_+	DUF3987 domain-containing protein	NA	A0A1I9L2G8	Xanthomonas_phage	40.1	1.1e-85
WP_096362144.1|2730969_2731596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169800566.1|2731737_2731896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905513.1|2731897_2732290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145980671.1|2732171_2732891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905514.1|2732887_2733463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066518725.1|2733592_2734441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096362145.1|2734834_2736868_-|transposase	transposase	transposase	K4ICM1	Acidithiobacillus_phage	33.3	2.8e-23
WP_066522357.1|2737030_2737909_+	OmpA family protein	NA	NA	NA	NA	NA
WP_066522372.1|2737964_2738477_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_066522359.1|2738624_2739032_-	low affinity iron permease family protein	NA	Q19XG2	Mycobacterium_phage	34.5	5.2e-06
WP_157080360.1|2739024_2739195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522363.1|2739381_2740233_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	41.3	6.1e-49
WP_066522370.1|2740239_2740884_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_066522499.1|2741023_2742094_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_066522145.1|2742236_2742542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522143.1|2742538_2744128_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_145980672.1|2744124_2744397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522138.1|2744569_2745934_+	TolC family protein	NA	NA	NA	NA	NA
WP_066522152.1|2745945_2746968_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_066522135.1|2746967_2748158_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_066522149.1|2748154_2749282_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_179948861.1|2749393_2751445_-	TonB-dependent receptor	NA	NA	NA	NA	NA
2751745:2751796	attL	CTTGCCAAGGTTGGGGTCGAGGGTTCGAATCCCTTCGCCCGCTCCAGTTTTC	NA	NA	NA	NA
WP_006964003.1|2752215_2752380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522386.1|2752485_2752965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096362194.1|2753461_2754190_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.6	1.1e-33
WP_096362065.1|2754176_2755691_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066521275.1|2755924_2756710_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_066521276.1|2756703_2759433_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_123905516.1|2759780_2760218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174521991.1|2763501_2766261_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.1	2.7e-29
WP_066521282.1|2766287_2771444_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	5.9e-54
WP_066521286.1|2771440_2772301_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_066521290.1|2772643_2773621_+	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	33.7	4.6e-32
WP_066521292.1|2773617_2774016_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	47.2	4.0e-19
WP_096362065.1|2776166_2777681_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_096362194.1|2777667_2778396_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.6	1.1e-33
WP_083949261.1|2779819_2780437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522276.1|2780454_2780943_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_066522275.1|2780945_2781260_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_066522272.1|2781346_2782615_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2782794:2782845	attR	CTTGCCAAGGTTGGGGTCGAGGGTTCGAATCCCTTCGCCCGCTCCAGTTTTC	NA	NA	NA	NA
>prophage 8
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	3132194	3164436	3767292	tRNA,terminase,tail,transposase,capsid,head,plate,portal	Burkholderia_phage(16.0%)	43	NA	NA
WP_096362194.1|3132194_3132923_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.6	1.1e-33
WP_096362065.1|3132909_3134424_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_096362169.1|3134760_3135768_-	late control protein	NA	K4PAY4	Burkholderia_phage	44.6	3.7e-69
WP_066519771.1|3135764_3136175_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	47.2	9.8e-29
WP_066519770.1|3136183_3136369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519767.1|3136380_3138834_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	44.1	8.4e-75
WP_066519765.1|3138833_3138974_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	61.8	3.4e-05
WP_066519762.1|3138982_3139288_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	56.3	3.6e-20
WP_066519757.1|3139353_3139869_-|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	52.4	1.6e-44
WP_066519751.1|3139899_3141069_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	F1BUU3	Erwinia_phage	57.1	1.8e-115
WP_066519749.1|3141084_3141432_-	GPW/gp25 family protein	NA	A0A1S5NNH3	Burkholderia_phage	46.9	6.4e-21
WP_066519747.1|3141419_3141959_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	46.4	1.4e-35
WP_066519744.1|3142008_3142290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519741.1|3142286_3142916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905529.1|3142912_3143572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519737.1|3143581_3144397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519729.1|3144377_3144575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157080319.1|3144590_3146834_-	hypothetical protein	NA	A0A1X9SGY8	Bradyrhizobium_phage	36.8	7.9e-120
WP_066519720.1|3146845_3148033_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	38.2	1.6e-07
WP_066519718.1|3148029_3148914_-|plate	baseplate J/gp47 family protein	plate	A0A193GYM8	Enterobacter_phage	40.3	1.8e-43
WP_066519711.1|3149000_3149678_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	34.1	2.0e-18
WP_066519708.1|3149687_3150206_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	44.9	3.5e-23
WP_083949146.1|3150205_3150388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519705.1|3150332_3150731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519702.1|3150727_3151180_-	hypothetical protein	NA	A0A1B1IWJ5	uncultured_Mediterranean_phage	53.7	5.7e-38
WP_066519700.1|3151185_3151518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519698.1|3151521_3151746_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	44.3	2.4e-05
WP_066519695.1|3151745_3152228_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	46.8	5.7e-28
WP_066519693.1|3152224_3152485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519691.1|3152604_3153396_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	42.1	7.5e-33
WP_066519689.1|3153448_3154501_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	49.6	1.2e-81
WP_066519686.1|3154540_3155383_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	42.5	7.2e-42
WP_083949142.1|3155544_3157398_+	oxidoreductase	NA	A4JWU9	Burkholderia_virus	53.7	4.4e-177
WP_066519682.1|3157394_3158444_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	58.3	9.1e-103
WP_066519675.1|3158593_3159403_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	59.7	1.9e-84
WP_066519673.1|3159422_3159710_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_066519793.1|3159735_3160026_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	58.9	1.4e-24
WP_066519670.1|3160096_3160402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169800571.1|3160398_3160566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519668.1|3161118_3161802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066519667.1|3162068_3162785_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_066519663.1|3162781_3163522_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_066519656.1|3163518_3164436_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	3349274	3354785	3767292		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_066518344.1|3349274_3350057_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.5	2.5e-28
WP_066518342.1|3350053_3350647_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.4	5.2e-39
WP_066518340.1|3350675_3350912_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	75.0	6.7e-06
WP_066518338.1|3350941_3351346_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_066518336.1|3351342_3352119_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.4	1.4e-44
WP_066518334.1|3352185_3352314_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_066518331.1|3352634_3353576_-	cell wall hydrolase	NA	A0A1B0UXM4	Roseobacter_phage	42.9	5.1e-20
WP_066518401.1|3353789_3354785_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	41.3	1.0e-50
>prophage 10
NZ_AP017655	Sphingobium cloacae strain JCM 10874 chromosome SCLO_1	3767292	3638682	3707136	3767292	tRNA,tail,transposase,capsid,head,protease,portal	Pseudomonas_phage(14.29%)	78	NA	NA
WP_066514702.1|3638682_3639408_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_066514769.1|3639785_3640250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066514704.1|3640304_3641513_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	47.6	2.5e-96
WP_066514770.1|3641571_3643134_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_066514705.1|3643142_3643778_-	DedA family protein	NA	NA	NA	NA	NA
WP_066514706.1|3643789_3644311_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_123905537.1|3644441_3645170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514709.1|3645317_3645560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514773.1|3645681_3646395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514777.1|3646573_3647221_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_066514715.1|3647376_3647952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514717.1|3647972_3649286_+	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.2	1.1e-73
WP_066514720.1|3649347_3649686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514722.1|3650113_3651247_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	39.2	5.6e-50
WP_169800534.1|3651243_3651408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066514780.1|3651475_3651796_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	41.4	2.6e-08
WP_066514725.1|3651792_3652233_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	36.3	2.6e-11
WP_066514728.1|3652335_3653472_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	44.1	2.0e-79
WP_123905538.1|3653544_3655194_+|tail	tail fiber domain-containing protein	tail	A0A1S5R3Z4	Pseudomonas_phage	37.3	6.5e-31
WP_169800537.1|3655183_3655357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514732.1|3655353_3655632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514740.1|3655628_3656171_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_096362181.1|3656167_3656374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066514744.1|3656370_3656775_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_066520132.1|3656964_3657288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066520139.1|3657342_3657750_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_066520142.1|3657746_3658061_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_066520144.1|3658057_3658267_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_066520147.1|3658287_3658854_+|tail	tail tape measure protein	tail	D6PEW0	uncultured_phage	36.3	7.8e-08
WP_066520149.1|3658850_3661181_+	DUF2460 domain-containing protein	NA	A0A2H4P7I1	Pseudomonas_phage	31.9	1.6e-38
WP_066520152.1|3661990_3662404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520155.1|3662407_3664618_+	hypothetical protein	NA	K4JVV3	Caulobacter_phage	34.1	7.4e-22
WP_066520158.1|3664636_3665140_+	DUF2793 domain-containing protein	NA	NA	NA	NA	NA
WP_066520159.1|3665318_3666383_+	OmpA family protein	NA	NA	NA	NA	NA
WP_169925544.1|3666443_3666680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066520160.1|3666636_3667194_+	superoxide dismutase family protein	NA	B6S2G0	Adoxophyes_orana_nucleopolyhedrovirus	35.4	5.3e-09
WP_066520224.1|3667234_3667774_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_066520161.1|3667893_3668634_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_066520162.1|3668685_3669315_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_066520164.1|3669506_3671825_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.0	4.7e-176
WP_066520171.1|3671981_3672179_-	DUF1192 domain-containing protein	NA	NA	NA	NA	NA
WP_066520226.1|3672273_3673278_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_066520174.1|3673379_3674246_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	49.0	3.6e-65
WP_066520175.1|3674257_3675286_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_066520176.1|3675400_3676084_+	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_066520177.1|3676225_3677926_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.4	6.3e-21
WP_066520178.1|3677969_3678503_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_066520228.1|3678586_3678850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520181.1|3678897_3679854_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	36.6	4.3e-35
WP_066520183.1|3679963_3680779_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_066520189.1|3680782_3682111_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_169925563.1|3682172_3682346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174521982.1|3682562_3682772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520191.1|3682775_3683720_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_066520193.1|3683716_3684625_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	43.2	1.0e-09
WP_066520196.1|3684584_3684989_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066520236.1|3685037_3686435_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	31.1	1.2e-28
WP_083949161.1|3686579_3686783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520199.1|3686782_3687631_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_174521983.1|3687879_3689268_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_066520202.1|3689302_3690361_-	potassium channel family protein	NA	NA	NA	NA	NA
WP_083949162.1|3690357_3691365_-	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	36.1	1.4e-15
WP_066520245.1|3691398_3692163_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	37.4	1.4e-36
WP_066520208.1|3692174_3693452_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.7	3.4e-96
WP_066520248.1|3693539_3693980_+	host attachment protein	NA	NA	NA	NA	NA
WP_066520215.1|3694055_3695318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083949163.1|3695534_3696041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096362065.1|3696159_3697674_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_096362194.1|3697660_3698389_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.6	1.1e-33
WP_123905540.1|3698581_3698956_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157080353.1|3699028_3699712_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_066522107.1|3699718_3699988_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_083949251.1|3699993_3701274_-	cytochrome P450	NA	NA	NA	NA	NA
WP_066522099.1|3701306_3702053_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_066522096.1|3702197_3702737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522090.1|3702860_3705179_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066522088.1|3705809_3706502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096362183.1|3706572_3707136_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP017657	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence	151712	7657	59043	151712	transposase,integrase,protease	Escherichia_phage(33.33%)	51	NA	NA
WP_020819377.1|7657_8785_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_037487321.1|9021_10218_+	NnrS family protein	NA	NA	NA	NA	NA
WP_164975689.1|10359_10650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066521301.1|10964_11360_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_037487485.1|11512_11866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013054031.1|11950_12715_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_096362250.1|12828_13359_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066522310.1|14002_14284_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_066522313.1|14280_14706_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_066522316.1|15758_16412_+	ParA family protein	NA	A0A0M3ULE3	Mycobacterium_phage	31.8	3.0e-11
WP_066522319.1|16411_16747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522322.1|16743_17703_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_006961816.1|18625_19492_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	40.0	4.8e-25
WP_006961814.1|19634_22544_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_157080356.1|23436_23601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066522250.1|23597_23816_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_066522247.1|23886_24159_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_066522244.1|24334_27262_+	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	25.4	2.7e-11
WP_174521996.1|27324_27570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522240.1|27573_28008_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_013054031.1|28746_29511_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_031293519.1|30049_31423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520910.1|31696_32947_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_066520914.1|33007_33685_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_169925567.1|33795_34695_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_123905549.1|34691_35141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905550.1|35152_36448_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_066520933.1|37021_38203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066520935.1|38193_38571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066520937.1|38557_39247_-	recombinase family protein	NA	NA	NA	NA	NA
WP_066520939.1|39386_40370_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_174521987.1|40385_40712_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_066520945.1|40899_41649_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_066520949.1|41685_42036_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_066520951.1|42082_42331_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_066520955.1|42317_42737_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_066520958.1|42908_43319_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066520979.1|43395_44046_+	cation transporter	NA	NA	NA	NA	NA
WP_066520962.1|44186_44522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066520965.1|44580_45945_+	TolC family protein	NA	NA	NA	NA	NA
WP_066520967.1|45941_47120_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_123905551.1|47123_50381_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_066520969.1|50380_50728_+	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_066520973.1|50875_51376_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_066520976.1|54165_54768_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.6	9.4e-28
WP_066520988.1|54799_55156_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_066520978.1|55148_55433_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_083949185.1|55558_56197_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096362251.1|56196_56634_+|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_013039223.1|56691_58062_+|transposase	IS1380-like element ISSp1 family transposase	transposase	NA	NA	NA	NA
WP_083949234.1|58455_59043_+|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
>prophage 1
NZ_AP017658	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence	108910	5280	70246	108910	transposase	Escherichia_phage(17.86%)	46	NA	NA
WP_001389365.1|5280_6045_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_061939919.1|8139_9093_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	33.0	1.9e-30
WP_061939951.1|9089_9413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061939917.1|9412_10066_-	ParA family protein	NA	M4HZI5	Mycobacterium_phage	33.3	3.9e-11
WP_066522052.1|10138_10771_-	SprT-like domain-containing protein	NA	A0A1V0DYF5	Dinoroseobacter_phage	47.3	9.5e-39
WP_174521995.1|11174_14102_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.6	1.4e-225
WP_066522055.1|14270_14864_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	56.6	3.4e-46
WP_007683408.1|15853_16552_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_001389365.1|17366_18131_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_096362260.1|19913_21446_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_096362261.1|21982_23578_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_082734689.1|24296_24716_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062346440.1|24712_25084_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	30.4	1.9e-07
WP_066522435.1|25378_26872_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.5	7.9e-92
WP_082734689.1|27200_27620_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062346440.1|27616_27988_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	30.4	1.9e-07
WP_066522435.1|28282_29776_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.5	7.9e-92
WP_006961814.1|30457_33367_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_006961816.1|33509_34376_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	40.0	4.8e-25
WP_011950653.1|36585_37146_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	45.4	3.5e-29
WP_066522521.1|37213_37978_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.5	1.2e-88
WP_123905556.1|38166_39159_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_066522521.1|39454_40219_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.5	1.2e-88
WP_083949265.1|42705_42972_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.0	4.4e-06
WP_066522399.1|43019_43313_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_066522401.1|43300_43579_-	CopG family ribbon-helix-helix protein	NA	NA	NA	NA	NA
WP_016746447.1|43743_46635_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.8	2.4e-190
WP_008832583.1|46760_47381_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	1.6e-38
WP_007686150.1|47377_47908_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_061939936.1|48455_48899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061939934.1|49699_49978_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.7	1.3e-19
WP_061939959.1|49988_50273_+	HigA family addiction module antidote protein	NA	A0A2I7RTP8	Vibrio_phage	44.3	1.2e-06
WP_061939932.1|50584_51958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061939957.1|51958_52528_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	46.6	9.2e-33
WP_048575129.1|52668_55638_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.8	1.1e-198
WP_061939930.1|55863_58779_-	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	25.5	3.9e-10
WP_061939928.1|58948_59272_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_061939955.1|59291_59534_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_061939926.1|59514_59799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061939953.1|60506_63440_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	34.4	1.9e-150
WP_061939924.1|63586_64192_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	45.5	1.5e-33
WP_061939921.1|64188_65550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066522435.1|65873_67367_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.5	7.9e-92
WP_062346440.1|67661_68033_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	30.4	1.9e-07
WP_082734689.1|68029_68449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001389365.1|69481_70246_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_AP017658	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_4, complete sequence	108910	84856	105639	108910	transposase	uncultured_Caudovirales_phage(28.57%)	22	NA	NA
WP_096362064.1|84856_86119_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	32.7	1.3e-39
WP_066522470.1|86115_86976_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.0	4.0e-56
WP_096362263.1|87002_87911_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.8	4.4e-13
WP_007688046.1|87910_88675_-	ParA family protein	NA	B0ZSI1	Halomonas_phage	28.9	8.9e-07
WP_007688055.1|88687_88864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007688057.1|89055_89448_-	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	44.0	5.0e-14
WP_066564291.1|89707_90058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031295760.1|90196_90718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007688065.1|90825_90990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007688066.1|91295_91730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007688067.1|91805_92213_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	35.9	1.2e-13
WP_007688068.1|92620_93289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007688069.1|93401_94343_-	DUF2493 domain-containing protein	NA	A0A0D4DBJ6	Vibrio_phage	35.3	6.0e-05
WP_007688070.1|94690_95431_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.6	3.7e-74
WP_007688071.1|95430_95862_-	GNAT family N-acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	44.7	1.8e-20
WP_007688072.1|95858_96926_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_007688073.1|96922_97363_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	7.0e-49
WP_007688074.1|97359_97896_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	36.9	2.6e-21
WP_013849891.1|97908_98247_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007688077.1|98299_99223_-	DUF1738 domain-containing protein	NA	K4JTS1	Caulobacter_virus	40.2	8.1e-47
WP_007688079.1|99315_101328_-	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	27.5	4.5e-34
WP_013041753.1|101439_105639_-	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	25.8	1.2e-25
>prophage 1
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	0	1682	57701		Leptospira_phage(100.0%)	1	NA	NA
WP_019053942.1|659_1682_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	36.6	2.1e-11
>prophage 2
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	8862	12976	57701	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_096362271.1|8862_9888_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	24.3	5.7e-09
WP_096362272.1|10541_10928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169925571.1|10924_11299_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_096362273.1|11365_12976_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.9	5.2e-49
>prophage 3
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	18554	28138	57701	transposase	Salmonella_phage(33.33%)	7	NA	NA
WP_066522055.1|18554_19148_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	56.6	3.4e-46
WP_174521995.1|19316_22244_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.6	1.4e-225
WP_066522052.1|22647_23280_+	SprT-like domain-containing protein	NA	A0A1V0DYF5	Dinoroseobacter_phage	47.3	9.5e-39
WP_061939917.1|23352_24006_+	ParA family protein	NA	M4HZI5	Mycobacterium_phage	33.3	3.9e-11
WP_061939951.1|24005_24329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061939919.1|24325_25279_+	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	33.0	1.9e-30
WP_001389365.1|27373_28138_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 4
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	32215	36623	57701		Aeromonas_phage(33.33%)	5	NA	NA
WP_007688084.1|32215_33418_-	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	31.3	6.6e-41
WP_007688083.1|33613_34702_-	replication initiation protein	NA	NA	NA	NA	NA
WP_013041755.1|35088_35289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007688082.1|35368_35695_+	single-stranded DNA-binding protein	NA	A0A1X9SGJ7	Bradyrhizobium_phage	32.7	1.2e-05
WP_007688081.1|35756_36623_+	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.2	1.1e-08
>prophage 5
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	42474	45981	57701		Aeromonas_phage(33.33%)	4	NA	NA
WP_096362279.1|42474_42756_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	39.7	2.3e-05
WP_061939934.1|42766_43045_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	45.7	1.3e-19
WP_096362276.1|43216_43633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008832583.1|45360_45981_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	49.7	1.6e-38
>prophage 6
NZ_AP017659	Sphingobium cloacae strain JCM 10874 plasmid pSCLO_5, complete sequence	57701	49761	56147	57701	transposase	Escherichia_phage(50.0%)	5	NA	NA
WP_083949265.1|49761_50028_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.0	4.4e-06
WP_066522521.1|52513_53278_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.5	1.2e-88
WP_123905556.1|53573_54566_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_066522521.1|54754_55519_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.5	1.2e-88
WP_011950653.1|55586_56147_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	45.4	3.5e-29
