The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017457	Aurantimicrobium minutum strain KNC chromosome sequence1	1622386	76822	84738	1622386	tRNA	Staphylococcus_phage(50.0%)	8	NA	NA
WP_096380105.1|76822_78763_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	2.0e-55
WP_096380107.1|78773_79133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096380109.1|79146_79620_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	28.8	3.8e-08
WP_096380111.1|79616_80900_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	42.6	1.2e-85
WP_096380114.1|80901_81528_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.4	9.4e-31
WP_096383345.1|81531_82530_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.8	1.8e-36
WP_096380115.1|82818_83892_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_096380118.1|83898_84738_-	endonuclease/exonuclease/phosphatase family protein	NA	M1PSC0	Streptococcus_phage	26.6	1.1e-10
>prophage 2
NZ_AP017457	Aurantimicrobium minutum strain KNC chromosome sequence1	1622386	1093728	1102275	1622386		Bacillus_phage(33.33%)	9	NA	NA
WP_096382158.1|1093728_1095363_+	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	25.8	5.9e-16
WP_096382161.1|1095476_1096169_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	4.4e-37
WP_096382163.1|1096265_1097717_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	8.6e-27
WP_096382166.1|1097864_1098155_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_096382168.1|1098218_1099838_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.0	3.0e-153
WP_172418262.1|1100018_1101056_-	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_096382174.1|1101124_1101328_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.2	8.9e-15
WP_096382176.1|1101456_1102005_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_096382178.1|1102017_1102275_-	DUF3263 domain-containing protein	NA	A0A0A7RXU7	Mycobacterium_phage	52.3	1.5e-11
>prophage 3
NZ_AP017457	Aurantimicrobium minutum strain KNC chromosome sequence1	1622386	1120992	1146145	1622386	integrase,tail,portal	Streptomyces_phage(27.78%)	38	1116989:1117032	1146276:1146319
1116989:1117032	attL	ACTTTTAATCCGAGGGTCGTGGGTTCGATCCCCACGGGGCCTAC	NA	NA	NA	NA
WP_096382224.1|1120992_1123320_-|tail	tail fiber protein	tail	A0A291AVB5	Streptomyces_phage	45.4	2.3e-82
WP_096382226.1|1123319_1124183_-|tail	phage tail family protein	tail	A0A291AVF6	Streptomyces_phage	32.1	4.0e-32
WP_096382229.1|1124176_1125664_-	hypothetical protein	NA	A0A2R4A170	Microbacterium_phage	37.0	3.2e-29
WP_096382234.1|1126025_1126286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382236.1|1126373_1126898_-	hypothetical protein	NA	A0A1U9WRZ9	Gordonia_phage	32.0	9.1e-11
WP_096382239.1|1126982_1127390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382242.1|1127389_1127638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382244.1|1127630_1127951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382246.1|1127953_1128553_-	hypothetical protein	NA	A0A2P1CI81	Actinomyces_phage	36.2	2.0e-17
WP_096382249.1|1128643_1129459_-	hypothetical protein	NA	A0A0S1S2Y1	Mycobacterium_phage	39.4	1.1e-42
WP_096382252.1|1129476_1130052_-	hypothetical protein	NA	Q6VY53	Streptomyces_phage	35.8	5.7e-06
WP_096382254.1|1130122_1130944_-	hypothetical protein	NA	A0A0K1Y588	Streptomyces_phage	38.2	4.2e-39
WP_096382257.1|1130930_1132268_-|portal	phage portal protein	portal	A0A2D2W4J2	Gordonia_phage	37.3	2.9e-77
WP_096382259.1|1132277_1133966_-	Terminase	NA	A0A1B3AY92	Gordonia_phage	48.5	2.1e-149
WP_096382262.1|1133958_1134435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382267.1|1135133_1135379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382269.1|1135705_1135936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382272.1|1135932_1136100_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_096382274.1|1136099_1137233_-	hypothetical protein	NA	A0A076YKT9	Mycobacterium_phage	42.3	1.2e-73
WP_096382277.1|1137222_1137447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382281.1|1137648_1138101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382283.1|1138403_1138808_-	single-stranded DNA-binding protein	NA	U5PT65	Clavibacter_phage	41.5	5.9e-18
WP_096382288.1|1139091_1139409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382290.1|1139405_1139585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382293.1|1139584_1140346_-	hypothetical protein	NA	A0A2P1N316	Gordonia_phage	44.4	1.8e-23
WP_148664057.1|1140345_1140687_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_096382298.1|1140698_1141058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382299.1|1141054_1141624_-	hypothetical protein	NA	A0A1J0MCV4	Streptomyces_phage	43.3	4.9e-26
WP_096382302.1|1141613_1142531_-	YqaJ viral recombinase family protein	NA	A0A2K9VGR3	Pontimonas_phage	32.0	7.9e-10
WP_096382304.1|1142527_1142881_-	hypothetical protein	NA	A0A142UM69	Mycobacterium_phage	45.0	1.5e-17
WP_172418267.1|1142880_1143018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382307.1|1143014_1143251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382308.1|1143348_1143639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096382311.1|1143750_1143948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096382313.1|1143944_1144175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096382316.1|1144253_1144619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096382319.1|1144615_1144981_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JRC2	Corynebacterium_phage	34.9	2.2e-08
WP_096382320.1|1144990_1146145_+|integrase	site-specific integrase	integrase	G8IR34	Mycobacterium_virus	32.0	8.9e-35
1146276:1146319	attR	ACTTTTAATCCGAGGGTCGTGGGTTCGATCCCCACGGGGCCTAC	NA	NA	NA	NA
>prophage 4
NZ_AP017457	Aurantimicrobium minutum strain KNC chromosome sequence1	1622386	1536754	1549050	1622386		Leptospira_phage(16.67%)	11	NA	NA
WP_096383153.1|1536754_1539937_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.4	1.7e-64
WP_096383155.1|1539966_1540890_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096383158.1|1540926_1541481_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	40.9	4.1e-22
WP_096383160.1|1541483_1542122_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	29.0	2.4e-13
WP_096383163.1|1542124_1542751_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096383166.1|1542845_1544132_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	33.7	5.1e-63
WP_096383168.1|1544213_1545128_+	DMT family transporter	NA	NA	NA	NA	NA
WP_096383563.1|1545167_1545455_+	chorismate mutase	NA	NA	NA	NA	NA
WP_096383170.1|1545457_1545910_+	HtaA domain-containing protein	NA	NA	NA	NA	NA
WP_096383173.1|1545906_1546743_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.8	9.9e-60
WP_096383176.1|1546758_1549050_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	79.9	0.0e+00
