The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014809	Methylorubrum populi strain P-1M	5705640	73861	107838	5705640	integrase,transposase	Leptospira_phage(33.33%)	27	71996:72040	117270:117314
71996:72040	attL	TGGTAGCGAGGGAGGGATTTGAACCCCCGACACAAGGATTATGAT	NA	NA	NA	NA
WP_096482869.1|73861_74960_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	1.4e-53
WP_157914055.1|75374_76040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096482871.1|76213_76420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157914056.1|76494_79155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096482875.1|79209_79913_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_157914057.1|80186_81098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096482880.1|81438_81924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096482882.1|82216_83599_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_096482884.1|84636_85950_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_096482885.1|86555_88277_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.7	3.6e-32
WP_043074399.1|88307_88739_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_059409521.1|89013_90150_+	thiolase family protein	NA	NA	NA	NA	NA
WP_043074400.1|90149_92471_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_096482887.1|92475_94260_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_043074401.1|94324_94633_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096482889.1|94697_95447_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_043074428.1|95517_96462_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_043074429.1|96538_97924_-	TolC family protein	NA	NA	NA	NA	NA
WP_157914058.1|98054_99857_-	FUSC family protein	NA	NA	NA	NA	NA
WP_043074402.1|99927_100956_-	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
WP_052516914.1|100971_101184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096482893.1|101766_102366_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043074405.1|102581_102773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096482775.1|103030_103785_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_162296242.1|103855_104662_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096482896.1|105545_106898_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096482898.1|107268_107838_+|integrase	site-specific integrase	integrase	K4JX14	Caulobacter_virus	32.0	3.2e-17
117270:117314	attR	TGGTAGCGAGGGAGGGATTTGAACCCCCGACACAAGGATTATGAT	NA	NA	NA	NA
>prophage 2
NZ_AP014809	Methylorubrum populi strain P-1M	5705640	1565750	1575542	5705640	protease,head,tail	Paracoccus_phage(40.0%)	12	NA	NA
WP_096484452.1|1565750_1569683_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	36.4	5.9e-195
WP_096487764.1|1569710_1570175_-	peptidase P60	NA	A0A1V0DYB6	Dinoroseobacter_phage	47.5	5.9e-30
WP_096484453.1|1570197_1571091_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	39.4	2.5e-53
WP_096484454.1|1571113_1571755_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	47.3	8.1e-46
WP_096487765.1|1571766_1572393_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	65.1	4.3e-07
WP_096484455.1|1572392_1572623_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_096484456.1|1572619_1572946_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_096484457.1|1572948_1573359_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_096484458.1|1573388_1573808_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_096484459.1|1573804_1574146_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_096484460.1|1574168_1574744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096484461.1|1574777_1575542_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_AP014809	Methylorubrum populi strain P-1M	5705640	2813183	2821508	5705640	integrase	Brucella_phage(16.67%)	14	2815642:2815659	2826425:2826442
WP_096485404.1|2813183_2814239_+	AAA family ATPase	NA	A0A141GF08	Brucella_phage	28.4	2.2e-24
WP_157914184.1|2814240_2814468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096485405.1|2814376_2814910_+	helix-turn-helix domain-containing protein	NA	F4YXP8	Roseobacter_phage	46.5	3.9e-09
WP_096485406.1|2814906_2815359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157914185.1|2815399_2815684_-	hypothetical protein	NA	NA	NA	NA	NA
2815642:2815659	attL	CCGGCACCAGCATCGGCA	NA	NA	NA	NA
WP_096485408.1|2815834_2816260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096485409.1|2816265_2817342_+	hypothetical protein	NA	Q8W6F2	Sinorhizobium_phage	46.0	2.3e-77
WP_096485410.1|2817347_2818493_+	phage Gp37/Gp68 family protein	NA	A0A0A8ILD3	Aurantimonas_phage	51.1	6.0e-92
WP_096485411.1|2818489_2818798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157914186.1|2818920_2819151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096487835.1|2819243_2819627_+	hypothetical protein	NA	A0A2P1JRA0	Mycobacterium_phage	46.7	1.0e-19
WP_096485413.1|2819623_2820133_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_157914187.1|2820188_2820389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096485415.1|2820302_2821508_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	27.3	5.9e-13
2826425:2826442	attR	TGCCGATGCTGGTGCCGG	NA	NA	NA	NA
>prophage 4
NZ_AP014809	Methylorubrum populi strain P-1M	5705640	5053173	5067890	5705640	capsid,head	uncultured_Caudovirales_phage(33.33%)	19	NA	NA
WP_096487125.1|5053173_5055090_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.7	5.3e-32
WP_157914257.1|5055082_5055232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487126.1|5055273_5055672_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	35.0	1.2e-10
WP_096487127.1|5055679_5056135_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_096487128.1|5056148_5057645_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.1	2.3e-115
WP_096487129.1|5057647_5058286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487130.1|5058266_5058683_-	hypothetical protein	NA	A0A0P0HSK8	Acinetobacter_phage	36.7	1.7e-12
WP_096487131.1|5058682_5058928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487132.1|5058924_5059425_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	41.4	3.6e-25
WP_096487133.1|5059424_5059826_-	DUF4054 domain-containing protein	NA	A0A0P0IKR4	Acinetobacter_phage	36.2	2.6e-10
WP_096487134.1|5059836_5060361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487135.1|5060372_5061413_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	49.2	2.6e-78
WP_096487136.1|5061492_5062017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487137.1|5062048_5063437_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	38.0	5.1e-45
WP_157914258.1|5063440_5063923_-|head	phage prohead protein	head	A0A2H4J4I9	uncultured_Caudovirales_phage	38.2	3.6e-22
WP_096487139.1|5064002_5064842_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	46.7	1.2e-49
WP_096487140.1|5064857_5065076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096487141.1|5065095_5066610_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	50.0	3.9e-115
WP_096488002.1|5066636_5067890_-	DNA-packaging protein	NA	A0A0U4IJ26	Arthrobacter_phage	37.6	2.1e-58
