The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	376142	385053	4116770	protease	Bacillus_phage(33.33%)	8	NA	NA
WP_096463356.1|376142_377432_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.7	5.6e-70
WP_157737761.1|377559_378198_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	48.6	7.9e-25
WP_096463358.1|378318_379038_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	3.7e-39
WP_096463359.1|379034_380849_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.4	1.1e-31
WP_096463360.1|380835_382200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096463361.1|382186_382966_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_096463362.1|383017_383815_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	40.0	9.2e-47
WP_096463363.1|383841_385053_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.8	4.2e-11
>prophage 2
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	617299	624347	4116770		Enterobacteria_phage(50.0%)	8	NA	NA
WP_096463552.1|617299_618250_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	24.3	1.3e-18
WP_096463553.1|618275_618920_+	NeuD/PglB/VioB family sugar acetyltransferase	NA	NA	NA	NA	NA
WP_096463554.1|618927_619755_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	53.5	9.1e-74
WP_096467611.1|619961_621056_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.7	4.5e-20
WP_096463555.1|621070_621940_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.9	6.2e-105
WP_096463556.1|621964_622753_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_096463557.1|622765_623314_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	42.3	3.8e-36
WP_096463558.1|623327_624347_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.7	3.1e-79
>prophage 3
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	1709773	1771014	4116770	head,terminase,tail,portal,tRNA,protease,capsid	Bacillus_phage(48.39%)	79	NA	NA
WP_096465028.1|1709773_1710535_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_096465030.1|1710682_1711030_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_096465032.1|1711101_1711659_+	signal peptidase I	NA	NA	NA	NA	NA
WP_096465034.1|1711681_1712581_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_096467689.1|1712677_1713436_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	40.2	6.1e-24
WP_096465035.1|1713457_1714930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465037.1|1714926_1715211_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_096465039.1|1715207_1715570_+	YraN family protein	NA	NA	NA	NA	NA
WP_157737883.1|1715792_1716869_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_096465043.1|1716846_1718445_-	recombinase family protein	NA	A0A0K2CYN0	Paenibacillus_phage	50.8	8.3e-140
WP_146226556.1|1718556_1719135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465046.1|1719127_1719727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465048.1|1720155_1721064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465050.1|1721153_1721711_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_096465052.1|1721776_1722229_-	SHOCT domain-containing protein	NA	A0A1D9C9Q4	Salinivibrio_phage	29.9	2.6e-06
WP_096465054.1|1722323_1722698_-	helix-turn-helix transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	42.6	3.3e-07
WP_096465056.1|1722861_1723110_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096465058.1|1723248_1723476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157737885.1|1723613_1723757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465060.1|1723753_1723960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465061.1|1723956_1724214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465063.1|1724321_1724843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096465065.1|1724839_1725067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737887.1|1725063_1725216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465067.1|1725443_1725740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465069.1|1725755_1725959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737889.1|1726055_1726229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465071.1|1726240_1726825_+	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	29.3	2.9e-10
WP_096465073.1|1726965_1727799_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	50.4	4.8e-30
WP_096465075.1|1727927_1728932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737891.1|1728870_1729734_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	43.2	6.8e-56
WP_096465081.1|1729918_1730359_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	61.2	3.6e-45
WP_172890836.1|1731294_1731432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465083.1|1731677_1731977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465085.1|1731969_1732383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465087.1|1732396_1732765_+	hypothetical protein	NA	A0A1S5S893	Streptococcus_phage	37.1	1.4e-10
WP_096465089.1|1733014_1733677_+	hypothetical protein	NA	A0A2P1JTX0	Anoxybacillus_phage	40.4	5.5e-21
WP_146226555.1|1733935_1735024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465095.1|1735618_1735801_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	70.0	3.8e-17
WP_096465097.1|1735977_1736724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465099.1|1736788_1737148_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	54.0	1.4e-26
WP_096465101.1|1737221_1737524_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	26.5	7.8e-07
WP_096465103.1|1737644_1737968_+|terminase	phage terminase small subunit P27 family	terminase	A0A0K2CYB1	Paenibacillus_phage	72.9	1.1e-35
WP_096465105.1|1737942_1739724_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	68.9	1.6e-253
WP_096465107.1|1739755_1740964_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	49.1	6.8e-102
WP_096465109.1|1740938_1741685_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	52.6	5.0e-63
WP_096465111.1|1741677_1742817_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	70.5	7.2e-146
WP_096465112.1|1742831_1743095_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	49.4	5.2e-15
WP_096465114.1|1743108_1743333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465116.1|1743274_1743637_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	43.1	3.8e-16
WP_096465118.1|1743593_1744022_+	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	43.4	6.2e-26
WP_096465120.1|1744018_1744387_+	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	59.3	5.5e-31
WP_096465122.1|1744389_1744953_+|tail	phage tail protein	tail	A0A1B1P7S4	Bacillus_phage	42.9	4.3e-35
WP_096465124.1|1745021_1745336_+	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	33.7	8.7e-09
WP_096465126.1|1745512_1750723_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	54.0	7.0e-111
WP_096465128.1|1750722_1752141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465130.1|1752137_1752578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465132.1|1752589_1753330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465134.1|1753329_1754277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465136.1|1754277_1754526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737893.1|1754525_1754681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465138.1|1754806_1755034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465140.1|1755164_1755347_+	UviB-like protein	NA	J9PTZ1	Bacillus_phage	39.8	8.0e-07
WP_096465142.1|1755351_1756104_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9FZW0	Bacillus_phage	29.1	1.0e-15
WP_096465144.1|1756251_1756980_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_096465146.1|1757005_1757671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465148.1|1757814_1758948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737895.1|1759456_1759621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737897.1|1759717_1760062_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172890838.1|1760136_1760667_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096465155.1|1760862_1760991_+	sporulation histidine kinase inhibitor Sda	NA	NA	NA	NA	NA
WP_096465157.1|1761187_1762348_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_096465159.1|1762375_1763284_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_096465161.1|1763391_1764498_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	42.2	1.0e-32
WP_096465163.1|1764574_1766656_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	40.0	1.6e-103
WP_096465165.1|1766677_1767985_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_096465167.1|1768131_1769034_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	34.1	2.2e-33
WP_096465169.1|1769057_1769603_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_096465171.1|1769616_1771014_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.1	7.7e-41
>prophage 4
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	2244949	2252914	4116770		unidentified_phage(16.67%)	9	NA	NA
WP_096467722.1|2244949_2246005_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	34.7	3.4e-57
WP_096467723.1|2246063_2246804_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	65.2	3.4e-88
WP_096465903.1|2246916_2248677_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	29.6	5.0e-45
WP_110546190.1|2248729_2249158_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	66.7	1.1e-41
WP_110546191.1|2249166_2250300_-	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	56.1	5.0e-107
WP_096465904.1|2250347_2250695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465905.1|2250741_2251161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096465906.1|2251187_2251517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096465907.1|2251660_2252914_-	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	41.4	3.2e-38
>prophage 5
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	2315744	2325960	4116770		Bacillus_phage(40.0%)	18	NA	NA
WP_096465969.1|2315744_2316302_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	44.3	8.4e-31
WP_096465970.1|2316303_2316768_+	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	51.0	1.9e-36
WP_096465971.1|2316802_2317021_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_096465972.1|2317022_2317361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737947.1|2317424_2318357_+	DnaD domain protein	NA	A0A0S2GLI6	Bacillus_phage	49.4	1.1e-38
WP_096465974.1|2318346_2318601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465975.1|2318607_2319981_+	hypothetical protein	NA	A0A1B1IQ90	uncultured_Mediterranean_phage	25.5	1.1e-07
WP_096465976.1|2319988_2320321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465977.1|2320322_2320727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146226544.1|2320747_2321764_+	hypothetical protein	NA	A7XXK6	Thermus_virus	25.1	6.7e-10
WP_096465979.1|2321766_2322036_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	59.5	6.7e-18
WP_096465980.1|2322032_2322257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737948.1|2322253_2322664_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_096465982.1|2322660_2323179_+	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	52.7	1.6e-47
WP_096465983.1|2323277_2323793_+	hypothetical protein	NA	D6R425	Bacillus_phage	56.5	4.4e-50
WP_096465984.1|2323918_2324362_+	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	48.3	3.1e-28
WP_096465985.1|2324575_2325271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096465986.1|2325285_2325960_+	hypothetical protein	NA	A0A0K2FLT2	Brevibacillus_phage	32.6	1.3e-17
>prophage 6
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	3030480	3106785	4116770	head,terminase,transposase,tail,portal,protease,integrase,capsid,plate	Bacillus_phage(36.0%)	83	3048311:3048331	3105291:3105311
WP_096466615.1|3030480_3031179_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_096467775.1|3031327_3031798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466616.1|3031918_3032878_-	asparaginase	NA	NA	NA	NA	NA
WP_096466617.1|3032892_3033864_-	YpdA family putative bacillithiol disulfide reductase	NA	G3MA85	Bacillus_virus	23.7	1.5e-06
WP_096466618.1|3033963_3035256_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_096466619.1|3035547_3036141_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_096466620.1|3036327_3037170_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_096466621.1|3037368_3039672_-	pyruvate synthase	NA	NA	NA	NA	NA
WP_096466622.1|3039693_3040698_-	2-oxoacid:acceptor oxidoreductase family protein	NA	NA	NA	NA	NA
WP_096466623.1|3041125_3042043_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096466624.1|3042035_3043691_-	helicase-associated domain-containing protein	NA	B2CRJ8	Acidianus_filamentous_virus	24.4	1.2e-16
WP_157738003.1|3043743_3044469_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157738004.1|3044521_3045121_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_096466626.1|3045107_3046682_-	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	34.4	4.4e-53
WP_157738005.1|3046685_3047759_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096466628.1|3047968_3048178_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	47.8	1.2e-11
3048311:3048331	attL	ATGTGGTCAAAATGTGGTCAA	NA	NA	NA	NA
WP_096466629.1|3048530_3048746_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	66.7	2.2e-19
WP_096466630.1|3049044_3049404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466631.1|3049708_3050254_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_096466632.1|3050276_3050873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096466633.1|3051097_3051298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466634.1|3051299_3052121_-	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	50.0	2.1e-38
WP_096466635.1|3052136_3052382_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_096466636.1|3052425_3052641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466637.1|3052875_3053439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466638.1|3053431_3053788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466639.1|3053792_3056600_-	exo-alpha-sialidase	NA	G3MAG8	Bacillus_virus	28.2	7.8e-16
WP_096467776.1|3056599_3056899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157738006.1|3056913_3057573_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_096466641.1|3057569_3058415_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_096466642.1|3058404_3058854_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_096466643.1|3058843_3059272_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_096466644.1|3059274_3060255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466645.1|3060264_3060912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466646.1|3060915_3064485_-|tail	tail tape measure protein	tail	S5MBW5	Brevibacillus_phage	28.0	1.9e-14
WP_096466647.1|3064688_3065099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466648.1|3065165_3065609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466649.1|3065612_3066965_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J187	uncultured_Caudovirales_phage	28.3	4.3e-20
WP_110546208.1|3066945_3067149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466651.1|3067181_3067676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466652.1|3067672_3068113_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_157738007.1|3068099_3068678_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_096466654.1|3068693_3069287_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	61.9	5.3e-07
WP_096466655.1|3069310_3069724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466656.1|3069775_3071014_-|capsid	phage major capsid protein	capsid	A0A142K632	Streptomyces_phage	47.8	4.1e-102
WP_096466657.1|3071014_3071665_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	48.2	4.4e-39
WP_096467777.1|3071684_3073694_-|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	34.3	5.6e-109
WP_096466658.1|3073733_3075428_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	66.5	2.1e-210
WP_096466659.1|3075427_3075955_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	64.1	1.3e-49
WP_096467778.1|3076054_3076450_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.1	1.5e-26
WP_096466660.1|3076556_3077594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157738008.1|3077786_3078044_-	stage V sporulation protein S	NA	NA	NA	NA	NA
WP_146226571.1|3078594_3078819_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	62.5	9.8e-07
WP_146226573.1|3078803_3078884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096466662.1|3078962_3079982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466663.1|3080066_3080444_-	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	38.8	7.0e-13
WP_096466664.1|3080455_3080707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466665.1|3080879_3081080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466666.1|3081173_3081425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466667.1|3081444_3082149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466668.1|3082242_3083571_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157738009.1|3083641_3084517_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	42.9	9.4e-61
WP_096466670.1|3084440_3085319_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SCN0	Streptococcus_phage	55.8	8.8e-43
WP_146226569.1|3085469_3085673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466672.1|3085952_3086228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466673.1|3086354_3086852_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096466674.1|3086995_3087211_-	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	52.5	2.2e-11
WP_096466675.1|3087225_3087486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172890899.1|3087661_3088309_+	helix-turn-helix domain-containing protein	NA	S5MAC0	Brevibacillus_phage	31.1	2.3e-11
WP_096467779.1|3088625_3088835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096466677.1|3088827_3092310_+	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_096466678.1|3092664_3093594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466679.1|3093786_3094275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096466680.1|3094334_3094826_+	DUF3993 domain-containing protein	NA	NA	NA	NA	NA
WP_096466681.1|3095144_3096698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096466682.1|3096794_3097499_-	DsbA family protein	NA	NA	NA	NA	NA
WP_110546202.1|3097935_3098790_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	51.1	1.4e-37
WP_096466683.1|3098814_3099120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096466684.1|3099230_3099644_-	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_096466685.1|3100512_3102999_-	S-layer homology domain-containing protein	NA	A0A222ZEQ0	Arthrobacter_phage	60.3	1.3e-06
WP_096466686.1|3103452_3103989_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_096466687.1|3104152_3105283_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.2	6.6e-83
WP_157738010.1|3106551_3106785_+|transposase	transposase	transposase	NA	NA	NA	NA
3105291:3105311	attR	ATGTGGTCAAAATGTGGTCAA	NA	NA	NA	NA
>prophage 7
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	3165168	3171695	4116770	protease	Staphylococcus_phage(57.14%)	8	NA	NA
WP_096466773.1|3165168_3165750_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.7	1.4e-17
WP_096466774.1|3165761_3166505_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	30.4	7.8e-08
WP_096466775.1|3166523_3167162_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_096466776.1|3167328_3167796_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.7	8.8e-42
WP_096466777.1|3167816_3169010_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	5.1e-110
WP_096466778.1|3169024_3169675_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	2.8e-33
WP_096466779.1|3169659_3170775_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	39.5	4.5e-60
WP_096466780.1|3171257_3171695_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.0	5.8e-19
>prophage 8
NZ_AP017312	Aneurinibacillus soli strain CB4	4116770	4039591	4049486	4116770		Prochlorococcus_phage(25.0%)	9	NA	NA
WP_096467503.1|4039591_4041133_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	8.2e-76
WP_096467504.1|4041163_4041769_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.7	4.0e-26
WP_096467505.1|4041768_4042809_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.8	3.0e-66
WP_096467824.1|4042821_4044246_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_096467506.1|4044242_4046543_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.4	1.9e-169
WP_096467507.1|4046451_4047144_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_096467508.1|4047147_4047396_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D7SRI3	Cyanophage	38.8	8.9e-09
WP_096467509.1|4047388_4048108_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	42.5	4.5e-45
WP_096467510.1|4048190_4049486_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.6	1.7e-18
