The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	1759704	1800442	5150567	tail,plate,tRNA	Bacillus_phage(14.29%)	34	NA	NA
WP_096447040.1|1759704_1760754_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_096447042.1|1760802_1761843_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_096452322.1|1761861_1762494_-	arylesterase	NA	NA	NA	NA	NA
WP_096452324.1|1762477_1763194_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	3.1e-09
WP_096447044.1|1763224_1764055_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_096447046.1|1764051_1765131_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	46.5	1.4e-74
WP_096447048.1|1765286_1765868_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_096447050.1|1765881_1768482_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.2	5.8e-42
WP_096447052.1|1768639_1769023_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_096447054.1|1769055_1771044_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	1.1e-19
WP_096447057.1|1771100_1771451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447059.1|1771625_1772765_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_096447061.1|1772768_1774424_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_096447063.1|1774613_1774982_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_096447065.1|1777339_1778572_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_096447067.1|1778571_1779360_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	40.5	1.0e-53
WP_096447069.1|1779673_1780804_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	40.5	2.5e-82
WP_096447071.1|1780893_1782093_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_096447073.1|1782325_1783594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748487.1|1783889_1784183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447077.1|1784206_1784794_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_096447079.1|1784855_1785686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447081.1|1785749_1787507_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_096447083.1|1787524_1787968_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096447085.1|1787992_1789585_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_096447087.1|1789584_1790103_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_096447089.1|1790106_1791273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748488.1|1791299_1791473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447091.1|1791557_1792643_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_096447093.1|1792642_1793329_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_157748489.1|1793328_1795092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447097.1|1795171_1795573_+	GPW/gp25 family protein	NA	R9S7U7	Prochlorococcus_phage	36.2	1.8e-06
WP_096447099.1|1795574_1797878_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_096447101.1|1797877_1800442_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 2
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	1983313	2057921	5150567	transposase,integrase	Enterobacteria_phage(22.22%)	57	1981925:1981940	1989535:1989550
1981925:1981940	attL	CCGAAGAGCCCGCCGA	NA	NA	NA	NA
WP_096447371.1|1983313_1984510_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_096447373.1|1984584_1985154_+	exosortase/archaeosortase family protein	NA	NA	NA	NA	NA
WP_157748504.1|1985887_1987387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447377.1|1987422_1989267_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_157748505.1|1989263_1989914_+	hypothetical protein	NA	NA	NA	NA	NA
1989535:1989550	attR	TCGGCGGGCTCTTCGG	NA	NA	NA	NA
WP_157748506.1|1989931_1990105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447381.1|1990681_1991857_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_096447383.1|1992275_1994858_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_096447385.1|1994867_1995674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447387.1|1996770_1999719_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	23.6	3.7e-53
WP_096447389.1|2000124_2000580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447391.1|2000576_2000870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_096447393.1|2001029_2001641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447396.1|2001637_2002228_-	exosortase/archaeosortase family protein	NA	NA	NA	NA	NA
WP_096447398.1|2002617_2003295_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_096447400.1|2003420_2003687_-	DUF1640 domain-containing protein	NA	Q2A091	Sodalis_phage	45.7	1.9e-09
WP_157748507.1|2004020_2005112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096445332.1|2006212_2007298_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096447404.1|2007895_2008153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157748508.1|2008284_2008920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447406.1|2009923_2011273_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	36.7	2.3e-42
WP_096447408.1|2011269_2012046_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	54.0	2.7e-67
WP_050416129.1|2013313_2014243_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_096447410.1|2014242_2015004_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_096452355.1|2015090_2018648_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_096447412.1|2018745_2019657_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096447414.1|2020051_2020486_-	hemerythrin	NA	NA	NA	NA	NA
WP_050416190.1|2020499_2021138_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	48.9	6.9e-45
WP_096447416.1|2021307_2022432_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096447418.1|2022469_2023270_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_096447420.1|2023266_2024322_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096447422.1|2024324_2025470_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096447424.1|2025603_2026911_-	amidohydrolase	NA	NA	NA	NA	NA
WP_096447426.1|2027073_2028348_-	cytochrome P450	NA	A0A2I2L575	Orpheovirus	25.2	7.1e-09
WP_018990584.1|2028601_2029372_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096447428.1|2029362_2030562_-	MFS transporter	NA	NA	NA	NA	NA
WP_096447430.1|2030588_2031644_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_096447432.1|2031640_2032915_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_096447434.1|2032927_2033665_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_096447436.1|2033691_2035923_-	CoA transferase	NA	NA	NA	NA	NA
WP_050416200.1|2035927_2036437_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_096447438.1|2036753_2037110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050416202.1|2037148_2038180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447440.1|2038245_2039520_-	cytochrome P450	NA	NA	NA	NA	NA
WP_096452357.1|2039780_2040434_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050416205.1|2040467_2042048_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_096447442.1|2042237_2042927_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096447444.1|2043116_2044748_+	ATP-dependent acyl-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	20.1	2.6e-08
WP_096447446.1|2044783_2045176_+	VOC family protein	NA	NA	NA	NA	NA
WP_096447447.1|2045754_2046450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447449.1|2046705_2047161_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	42.0	1.0e-18
WP_012585333.1|2047233_2047509_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_157748509.1|2048023_2049466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748510.1|2049471_2050461_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_096452359.1|2051237_2053265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447453.1|2055488_2057189_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_096447455.1|2057297_2057921_-|transposase	transposase	transposase	Q76S41	Shigella_phage	34.9	5.2e-05
>prophage 3
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	2183129	2227236	5150567	terminase,integrase,tail,transposase,lysis,tRNA	Burkholderia_phage(25.0%)	54	2185383:2185401	2234821:2234839
WP_096447591.1|2183129_2184218_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_096447593.1|2184446_2186024_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
2185383:2185401	attL	GCGGGCCGACGGCACCGCC	NA	NA	NA	NA
WP_096447595.1|2186179_2186380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748521.1|2186376_2186904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447599.1|2186887_2187514_-	regulatory protein GemA	NA	A0A2P9JZH5	Alteromonadaceae_phage	33.8	3.2e-10
WP_157748522.1|2187516_2187999_-	hypothetical protein	NA	A0A2D2W6T3	Pectobacterium_phage	44.1	3.6e-06
WP_157748523.1|2187995_2188205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447603.1|2188201_2188513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447605.1|2188514_2189225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748524.1|2189221_2189671_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	55.0	4.1e-36
WP_157748525.1|2189920_2190322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447612.1|2190318_2190666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748526.1|2190668_2191046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447616.1|2191042_2192221_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	37.7	3.8e-57
WP_157748527.1|2192220_2194023_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	39.3	2.0e-97
WP_096447621.1|2195153_2195459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096447623.1|2195455_2195941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096452375.1|2195958_2196171_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	54.4	1.5e-09
WP_096447625.1|2196247_2196745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096451997.1|2196793_2197599_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157748528.1|2197714_2197978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447627.1|2198481_2198868_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	49.1	5.1e-19
WP_096452377.1|2198892_2199507_+	lytic transglycosylase domain-containing protein	NA	Q6QIC7	Burkholderia_phage	49.0	6.4e-40
WP_096447629.1|2199503_2200115_+|lysis	lysis protein	lysis	Q5ZQY9	Pseudomonas_phage	41.5	3.6e-19
WP_096447631.1|2200111_2200351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096445332.1|2200423_2201509_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096447633.1|2201804_2202173_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	51.3	7.2e-23
WP_096447635.1|2202185_2202497_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	2.9e-33
WP_096447637.1|2202496_2203066_+	DUF3486 family protein	NA	Q6QIC2	Burkholderia_phage	38.6	1.3e-18
WP_096447639.1|2203062_2204520_+|terminase	phage terminase large subunit	terminase	A0A291AYH9	Shigella_phage	40.2	7.7e-84
WP_157748529.1|2204527_2204839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447643.1|2205079_2206513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447645.1|2206692_2207889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748530.1|2207872_2208112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447649.1|2208243_2208498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447651.1|2208494_2210741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447652.1|2210863_2211220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748531.1|2211252_2212263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447656.1|2212259_2212949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748532.1|2212948_2213461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447660.1|2213457_2213958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447662.1|2213981_2214929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447664.1|2214940_2215447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447666.1|2215455_2215737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447668.1|2215736_2218715_+|tail	phage tail tape measure protein	tail	A0A0A1IX77	Pseudomonas_phage	33.3	7.9e-35
WP_096447670.1|2218729_2219059_+|tail	phage tail protein	tail	A0A1B1IV54	uncultured_Mediterranean_phage	32.3	4.8e-10
WP_096447672.1|2219055_2219766_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	48.3	2.1e-58
WP_096447674.1|2219762_2220503_+	C40 family peptidase	NA	D6PG99	uncultured_phage	50.2	1.8e-65
WP_096447676.1|2220499_2221042_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	43.8	2.1e-26
WP_096447678.1|2221041_2224704_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	41.3	1.5e-165
WP_096447680.1|2224703_2225342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447682.1|2225338_2225824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447684.1|2225807_2226311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096447687.1|2226468_2227236_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	63.9	6.0e-96
2234821:2234839	attR	GGCGGTGCCGTCGGCCCGC	NA	NA	NA	NA
>prophage 4
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	2815509	2859354	5150567	transposase,protease,integrase	Mycobacterium_phage(25.0%)	29	2815254:2815270	2844096:2844112
2815254:2815270	attL	GCAAGTCGGCCAGGACG	NA	NA	NA	NA
WP_068803121.1|2815509_2816028_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_157748568.1|2816770_2816983_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082047735.1|2817066_2817321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096448516.1|2817453_2818380_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_096448518.1|2818420_2819005_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.3	8.2e-21
WP_052484401.1|2819070_2820510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448520.1|2820509_2822555_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_157748569.1|2822612_2824925_-	BREX-1 system phosphatase PglZ type B	NA	NA	NA	NA	NA
WP_096448522.1|2825070_2826756_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_157748570.1|2826790_2829484_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.4	1.3e-20
WP_096452499.1|2830590_2831396_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096448526.1|2831478_2833806_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_096448528.1|2833841_2835674_-	Hsp70 family protein	NA	A0A1V0SBC3	Catovirus	25.6	3.9e-24
WP_096448530.1|2835677_2836949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748571.1|2836941_2838072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448534.1|2838074_2841458_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_157748572.1|2841460_2842156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448538.1|2842152_2845614_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
2844096:2844112	attR	GCAAGTCGGCCAGGACG	NA	NA	NA	NA
WP_043743643.1|2845656_2846223_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_096448540.1|2846215_2846923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448542.1|2846991_2847204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448544.1|2847436_2848117_-	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	40.8	3.6e-36
WP_157748573.1|2848838_2849438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096448548.1|2849584_2850115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448550.1|2850514_2852200_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_096448552.1|2853834_2854440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096448554.1|2854467_2855052_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_096448556.1|2855121_2855922_-	pirin family protein	NA	NA	NA	NA	NA
WP_003049965.1|2856438_2859354_+|transposase	Tn3-like element IS1071 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	4063069	4072275	5150567		Staphylococcus_phage(16.67%)	10	NA	NA
WP_096450424.1|4063069_4064158_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.7	1.4e-50
WP_096450426.1|4064167_4064671_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	37.1	2.4e-13
WP_096450428.1|4064667_4065156_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_096452752.1|4065405_4065984_-	DUF3365 domain-containing protein	NA	NA	NA	NA	NA
WP_096450430.1|4066061_4066478_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_096450432.1|4066571_4067903_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.7	1.1e-49
WP_021248184.1|4068401_4068677_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	50.6	1.2e-14
WP_096450434.1|4068855_4069452_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_096452754.1|4069646_4070459_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.3	8.5e-08
WP_096450436.1|4070481_4072275_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FG22	Brazilian_cedratvirus	29.4	2.5e-12
>prophage 6
NZ_CP023439	Thauera sp. K11 chromosome, complete genome	5150567	4516558	4584317	5150567	transposase,tRNA,integrase	Bacillus_phage(18.18%)	54	4580529:4580588	4589871:4589957
WP_096451069.1|4516558_4517335_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_096451071.1|4517331_4518117_-	thiazole synthase	NA	NA	NA	NA	NA
WP_096451073.1|4518201_4518405_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_096452810.1|4518609_4519737_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_096451075.1|4519739_4520330_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_096451077.1|4520470_4522147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096451079.1|4522173_4522491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451081.1|4522781_4524302_+	MFS transporter	NA	NA	NA	NA	NA
WP_096452812.1|4524307_4525069_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_096451083.1|4525065_4525389_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_096451085.1|4525402_4526125_+	single-strand selective monofunctional uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_096451087.1|4526286_4526937_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_096451089.1|4527051_4529226_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_096451091.1|4529610_4530687_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_096451093.1|4530792_4532244_-	potassium transporter Trk	NA	NA	NA	NA	NA
WP_096451095.1|4532259_4533663_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_096451097.1|4533766_4535014_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.5	5.3e-09
WP_096452814.1|4535017_4537138_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.6	4.1e-09
WP_096451099.1|4537134_4537746_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_096451101.1|4537696_4539148_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_096451103.1|4539086_4539974_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_096451105.1|4542451_4543303_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_096451107.1|4543527_4543761_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096451109.1|4543771_4545340_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.8	1.1e-107
WP_096451111.1|4545336_4546641_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096451113.1|4546637_4549661_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.6	7.3e-28
WP_096451115.1|4550755_4552549_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_096451117.1|4552639_4553785_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	47.9	1.1e-77
WP_096451119.1|4553803_4554994_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	40.5	8.0e-71
WP_096451121.1|4555300_4555810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748657.1|4555814_4556060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748658.1|4556100_4556427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451123.1|4556423_4558940_-	DUF927 domain-containing protein	NA	A0A221SAP5	Ralstonia_phage	31.4	1.4e-11
WP_096451125.1|4558923_4559223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096452816.1|4559233_4559470_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096451127.1|4559635_4560343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451129.1|4560437_4560890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451131.1|4560932_4561211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748659.1|4561298_4561619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451135.1|4561636_4562941_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	38.9	4.3e-70
WP_096451137.1|4563287_4564640_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_096451139.1|4564611_4566276_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_096451141.1|4566309_4566519_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_096451143.1|4566515_4566878_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_002926183.1|4566879_4567014_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_096451145.1|4567297_4568794_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_096451147.1|4568839_4569949_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	33.2	2.7e-49
WP_157748660.1|4572912_4573608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096451151.1|4573573_4579933_-	ATP-binding protein	NA	NA	NA	NA	NA
4580529:4580588	attL	GCTTCTGGCCGATAGTACCGTCTCGGCATCACCACCGTAAGCTGCCGCCCGCCGCCTCAA	NA	NA	NA	NA
WP_096451153.1|4580616_4581237_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WI70	Clostridium_phage	31.4	5.0e-08
WP_096451155.1|4581469_4582420_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	3.2e-83
WP_096451157.1|4582668_4583571_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_157748661.1|4583557_4583920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096449809.1|4583999_4584317_+|transposase	transposase	transposase	NA	NA	NA	NA
4589871:4589957	attR	TTGAGGCGGCGGGCGGCAGCTTACGGTGGTGATGCCGAGACGGTACTATCGGCCAGAAGCAGTCGCCCAAGAAATCCAACATGATGG	NA	NA	NA	NA
>prophage 1
NZ_CP023440	Thauera sp. K11 plasmid pTX1, complete sequence	140963	4522	66013	140963	integrase,transposase	Salmonella_phage(16.67%)	54	2440:2454	73619:73633
2440:2454	attL	AGCGTGCGGATGACC	NA	NA	NA	NA
WP_096448561.1|4522_5155_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFD7	Streptococcus_phage	29.3	6.4e-11
WP_096448559.1|5300_6197_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096452501.1|6301_7372_+	alkene reductase	NA	NA	NA	NA	NA
WP_003159550.1|7437_7638_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	68.9	2.2e-18
WP_003049965.1|7820_10736_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_096448556.1|11252_12053_+	pirin family protein	NA	NA	NA	NA	NA
WP_096448554.1|12122_12707_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_096448552.1|12734_13340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096452951.1|17892_18429_-	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_096452953.1|18476_20381_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_096452955.1|20377_22711_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_096452957.1|22729_23191_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_096452959.1|23584_23962_+	TraK family protein	NA	NA	NA	NA	NA
WP_096452961.1|23961_24687_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_096452963.1|24683_25121_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_096452965.1|25568_25922_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_096452967.1|26315_26885_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_096452969.1|27680_28217_+	phasin family protein	NA	NA	NA	NA	NA
WP_157748692.1|28354_28645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748693.1|29004_29433_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_096452973.1|29517_29790_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_096452975.1|29777_30071_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_096452977.1|30176_31784_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	52.9	1.4e-150
WP_157748694.1|31780_32056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096452979.1|32184_32937_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.8	8.1e-53
WP_096452981.1|32933_34475_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.8	1.9e-85
WP_002943440.1|35199_35850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096452983.1|36275_37691_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	42.8	5.9e-97
WP_157748695.1|37693_38059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096452985.1|38061_38256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096452987.1|38252_38573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748696.1|38569_38914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157748697.1|38903_39164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096452993.1|39156_39723_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_096453144.1|39725_40526_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_096452995.1|40704_41742_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096452997.1|41875_42241_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157748698.1|43035_44055_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	1.2e-14
WP_096453001.1|44073_46026_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	7.0e-16
WP_096453003.1|46317_47115_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_096453005.1|47941_48943_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096453007.1|52124_52421_+	plasmid maintenance system killer protein	NA	NA	NA	NA	NA
WP_096453009.1|52436_53555_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_096453011.1|53839_55099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157748699.1|55546_58270_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_157748700.1|58405_58672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096453015.1|58796_59882_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_096453017.1|60074_61025_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_157748701.1|61405_61561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096453019.1|61572_62277_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_096453146.1|63042_63633_-	phosphatase	NA	NA	NA	NA	NA
WP_096453021.1|63705_64095_+|transposase	transposase	transposase	Q76S41	Shigella_phage	38.0	4.8e-09
WP_096453023.1|64091_64436_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.5	3.1e-36
WP_096453025.1|64492_66013_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	57.1	9.9e-151
73619:73633	attR	AGCGTGCGGATGACC	NA	NA	NA	NA
