The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	405383	442963	3578566	transposase,plate,holin	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405383_406847_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406980_408045_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408290_408959_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409052_409604_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409797_410658_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411725_412106_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412137_414441_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414471_414999_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415039_417061_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417064_418012_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|418008_418713_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418709_419813_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420161_420557_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420558_421287_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421484_421988_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422010_423261_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423447_423948_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424655_425861_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425857_427960_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427940_428480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428575_429700_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429692_430505_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430526_431261_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431614_433036_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433199_433553_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433570_434401_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434584_436075_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436171_436864_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438239_439359_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439498_439981_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440060_441899_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441862_442963_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	542510	595130	3578566	transposase,portal,protease,terminase	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542510_543032_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543253_543751_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543747_544803_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544846_545203_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545205_545502_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546309_547429_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548054_548327_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548445_549228_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549547_549976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550057_550933_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550925_551447_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551604_552618_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552701_553499_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553526_554375_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554452_555832_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555842_556520_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556809_557970_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|558005_558188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558442_560458_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560498_563528_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564065_565166_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565565_566525_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566647_567379_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567751_568474_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568470_569520_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569516_570395_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570399_571659_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571875_573381_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573436_573829_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573839_574649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574694_575492_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575576_577226_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577953_578295_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579468_580588_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581011_581317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581340_582327_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582356_583193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583651_584839_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584837_585974_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586580_587786_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587798_589922_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590285_591419_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591495_592062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592397_592853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593417_593858_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593844_593982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594009_595130_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	1211537	1220774	3578566		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1211537_1213490_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1213756_1214887_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1214920_1216927_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1217102_1217918_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1217982_1218666_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1218662_1219190_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1219226_1220774_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	1224264	1302206	3578566	transposase,tRNA,protease	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1224264_1225239_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1225235_1227290_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1227474_1228155_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1228475_1229303_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1229413_1230250_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1230520_1231948_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1232345_1234082_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1234361_1235513_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1235693_1236857_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1236938_1238486_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1238492_1239275_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1239271_1239928_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1239960_1241484_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1241506_1242829_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1242928_1243780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1243776_1245573_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1245590_1246526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1246522_1247365_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1247374_1248388_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1248403_1249444_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1249440_1250019_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1250020_1250713_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1250709_1251279_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1251545_1252748_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1252744_1253533_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1253534_1255067_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1255069_1262710_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1262706_1263624_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1263688_1265008_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1265016_1265709_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1266684_1267804_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1267878_1268097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1268294_1268804_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1269104_1271219_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1272391_1273855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1274399_1275245_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1275413_1276160_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1276875_1278237_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1278209_1278545_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1278841_1280281_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1280628_1280916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1280899_1282174_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1282298_1282904_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1283435_1284458_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1284473_1285001_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1285085_1285841_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1286074_1287280_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1287368_1288489_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1289551_1290130_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1290326_1291709_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1291703_1291934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1292166_1293195_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1293175_1293382_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1293555_1294347_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1294555_1295218_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1295352_1296816_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1296919_1297123_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1297655_1297970_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1297966_1300267_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1301085_1302206_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	1898496	1968611	3578566	transposase,plate,coat	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1898496_1899616_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1899661_1900252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1900593_1901100_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1901096_1901522_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1902267_1904160_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1904226_1905687_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1905909_1906287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1906310_1906889_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1907103_1909896_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1909892_1912115_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1912111_1913854_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1913880_1915989_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1918250_1921646_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1921642_1924990_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1925313_1925568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1925543_1927022_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1927204_1927495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1927729_1927948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473508.1|1928443_1928914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1928919_1929243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1929526_1930951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1931217_1932195_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1932608_1933391_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1933574_1933790_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1933800_1934172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1934223_1934559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1934641_1934800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1935165_1935861_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|1936248_1939521_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|1939601_1940312_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|1940313_1941843_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|1941859_1942204_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|1942626_1942869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1942914_1943475_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|1943509_1943998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|1944024_1946427_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|1946679_1946913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|1946957_1947794_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1947963_1948092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192127.1|1949085_1950936_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1950963_1952379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1952402_1952669_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1952928_1953156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1953189_1955997_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1955999_1956833_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1957066_1958187_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|1958922_1960236_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|1961130_1961400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1961652_1961934_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|1962401_1963394_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|1963438_1964635_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|1965141_1966035_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|1966372_1966594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|1966679_1966865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|1966851_1967397_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|1967449_1968010_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1968086_1968611_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	2031723	2102956	3578566	transposase,tRNA	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|2031723_2034591_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|2034730_2037094_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|2037090_2037879_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|2038200_2039451_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|2039802_2041479_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|2041826_2042708_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|2042721_2042925_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|2042921_2045123_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024901066.1|2045139_2046915_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|2047087_2048029_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|2048372_2049356_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|2049387_2050809_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|2050843_2051293_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|2051289_2051898_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|2052003_2053314_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|2053485_2053806_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|2054022_2054487_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|2054586_2056401_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|2056412_2056517_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|2056881_2057991_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|2058156_2058690_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|2058689_2059103_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|2059147_2060268_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2060355_2061531_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2061655_2064028_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2064196_2064445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2065450_2067001_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2067050_2068316_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2068466_2070146_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2070389_2070851_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2071087_2071498_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2071692_2072790_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2072896_2074327_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2074426_2075701_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2075828_2078693_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2079031_2080858_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2080810_2080951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2081150_2081648_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2081747_2083244_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2083311_2084547_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2084569_2086129_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2086399_2087335_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2087361_2087730_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2087835_2090763_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2090854_2092330_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2092326_2092788_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2093092_2094757_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2094820_2096149_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2096567_2097470_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2097888_2098290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2098495_2098753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2098911_2099229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2099429_2100152_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2100390_2100669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2100817_2101075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2101124_2101415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2101836_2102956_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	2796341	2862126	3578566	transposase,protease	Streptococcus_phage(36.36%)	46	NA	NA
WP_004191998.1|2796341_2797805_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2797913_2798483_-	phasin family protein	NA	NA	NA	NA	NA
WP_004191998.1|2800392_2801856_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2802112_2803882_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2804189_2805779_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2805911_2808608_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2808739_2808961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2808880_2811391_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2811387_2812026_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2812342_2813200_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004199570.1|2813156_2813372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2813885_2815985_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2816214_2817417_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2817369_2817654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2818139_2819420_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2819463_2820849_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2821099_2824825_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2824821_2826375_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2826371_2827076_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2827112_2827799_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2827940_2829863_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2829898_2830600_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2830746_2831523_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2831805_2833269_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2833402_2834938_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2834975_2836118_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2836284_2837700_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2838104_2838569_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2838821_2839640_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2839636_2840470_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2841013_2842003_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2842019_2843012_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2843113_2847241_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2847264_2848641_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2848693_2848969_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2849141_2850473_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2850681_2852208_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2852204_2853998_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2854106_2855009_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2855410_2856874_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2856990_2857557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2857700_2858821_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2858930_2859407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2859863_2860088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2860352_2861489_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2861586_2862126_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	3093449	3157356	3578566	transposase,protease	Leptospira_phage(25.0%)	60	NA	NA
WP_004192020.1|3093449_3094958_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3094974_3096027_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3096032_3096635_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3096718_3097318_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3097423_3097897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3097908_3099147_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3099303_3099543_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3099686_3100436_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3100486_3101419_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3101489_3102479_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3102478_3103585_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3103723_3103903_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3103999_3104632_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3104875_3105523_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3105519_3106242_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3106280_3107282_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3107291_3107687_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3107984_3108992_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192715.1|3109755_3113028_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004532083.1|3113167_3114280_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3114313_3114937_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3115048_3116359_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3116395_3116683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3116679_3117183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3117425_3118901_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3118897_3119887_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3119952_3121395_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3121450_3122113_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3122257_3123457_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3123541_3123808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3123725_3124049_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3124536_3125016_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3125606_3126395_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3126579_3127086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3127423_3127645_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3127769_3129176_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3129493_3130613_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3130809_3130983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3130997_3132392_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3132870_3133377_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_162473585.1|3133564_3133771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3134322_3135033_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3137871_3139335_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3139492_3141103_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3141115_3141298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3141270_3142530_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3142797_3143376_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3143569_3144690_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3145801_3146922_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197797.1|3147348_3147507_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_011203825.1|3147503_3148097_-	chorismate mutase	NA	NA	NA	NA	NA
WP_004189159.1|3148709_3149099_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004188913.1|3149245_3151582_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189437.1|3151590_3152841_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004203540.1|3152837_3153326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|3153612_3153864_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004197793.1|3154563_3154779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3155034_3155511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3155533_3155794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3156135_3157356_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	3210233	3219075	3578566		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3210233_3211634_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3211602_3212589_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3212647_3213640_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3213711_3214029_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3214352_3215255_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3215480_3216788_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3216966_3217890_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3218232_3219075_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009737	Burkholderia mallei strain Turkey7 chromosome 1, complete sequence	3578566	3480203	3537711	3578566	portal,transposase,tRNA,protease	Vibrio_phage(17.65%)	48	NA	NA
WP_004191998.1|3480203_3481667_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3481833_3482604_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3482635_3483475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3483601_3485074_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3485076_3486567_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3486679_3486979_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024901104.1|3487344_3488388_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3488507_3489581_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3489577_3490090_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3490273_3492682_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3492693_3493842_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3494164_3494941_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3494937_3495723_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3496144_3496597_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3496616_3497249_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3497342_3498077_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3498544_3499228_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3499228_3501637_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3501638_3502229_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3502225_3503635_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3504004_3504862_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3504971_3505607_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3505727_3506711_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3506742_3507246_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3507474_3508665_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3508724_3509096_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3509306_3511916_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3512137_3513193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3513642_3514659_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3514779_3515649_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3515686_3516091_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3516481_3517702_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_038802950.1|3519018_3520138_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3520190_3520673_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3520669_3520954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3521026_3522118_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3522516_3522927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3523063_3523939_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3523949_3525062_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3525090_3526185_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096325470.1|3528528_3529119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3529382_3530831_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3530849_3532463_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3532622_3533564_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3533560_3534655_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3535056_3535473_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3535658_3536213_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3536591_3537711_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009738	Burkholderia mallei strain Turkey7 chromosome 2, complete sequence	2146721	171115	214842	2146721	transposase,plate	Streptococcus_phage(40.0%)	29	NA	NA
WP_004191998.1|171115_172579_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004554722.1|172717_173617_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196258.1|173780_175028_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004188170.1|175180_176113_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188660.1|176657_177398_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004202300.1|177417_177702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|177841_178207_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004196252.1|178648_180565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|180776_183737_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011204674.1|183764_183995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|184301_185522_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004188150.1|185651_186710_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187705.1|187635_189120_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004187879.1|189165_191034_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	23.1	1.9e-18
WP_004187502.1|191062_192034_+	quinone oxidoreductase	NA	A0A2P1ELD9	Moumouvirus	25.2	6.6e-07
WP_004187006.1|192088_193015_+	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004196246.1|193257_194604_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188288.1|195189_195420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188530.1|199543_200809_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188743.1|200897_202244_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004187276.1|202265_202769_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188308.1|202875_203361_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004188012.1|203477_204977_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196243.1|205011_205593_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011204222.1|207750_209214_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004188539.1|210645_211392_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187921.1|211388_212354_+	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004187068.1|212340_212922_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187986.1|212952_214842_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009738	Burkholderia mallei strain Turkey7 chromosome 2, complete sequence	2146721	383888	454672	2146721	holin,tRNA,transposase	Acinetobacter_phage(45.45%)	58	NA	NA
WP_004521984.1|383888_385187_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004200645.1|385478_385790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198580.1|385786_386041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186938.1|386059_387874_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.6	3.0e-170
WP_004186966.1|388010_388562_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004186915.1|388558_389182_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004186903.1|389517_391185_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.2	2.2e-42
WP_004186876.1|391471_391783_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004202137.1|391922_392900_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_004198399.1|393015_393495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186796.1|393652_393874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186864.1|394157_395561_+	GABA permease	NA	NA	NA	NA	NA
WP_004186854.1|395632_396466_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186860.1|396479_396983_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_004206632.1|397197_397479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186874.1|397589_398684_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004186799.1|399209_399575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557275.1|399583_399940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266669.1|400031_400160_-	lipoprotein	NA	NA	NA	NA	NA
WP_004521997.1|400474_401656_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_004186871.1|401757_402486_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004186839.1|402585_404415_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_004549943.1|404553_405150_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004186801.1|405369_406149_-	uracil-DNA glycosylase	NA	A0A060Q589	Fruit_bat_alphaherpesvirus	51.1	6.4e-53
WP_004186832.1|406190_406832_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_004186826.1|406842_407628_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	9.3e-52
WP_004186823.1|407690_408722_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.6e-80
WP_004186792.1|408739_409330_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.0	1.4e-68
WP_004186866.1|409343_410837_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_004186872.1|411199_411928_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004186923.1|411924_412620_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004522004.1|412666_412876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186878.1|412801_413176_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_038719768.1|413284_414511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186945.1|414838_416137_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_004186957.1|416650_417442_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_004522007.1|417500_418703_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004186941.1|418791_420498_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_004198410.1|420628_421405_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_073699529.1|421801_421918_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_096325434.1|427536_428656_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|428897_430358_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_009967729.1|431936_432869_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011326545.1|433312_434002_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.8	2.2e-12
WP_024900894.1|434033_434768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|442562_443683_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004266245.1|444241_445312_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004184680.1|445374_445869_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.6	2.5e-26
WP_004184724.1|445903_446383_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004198701.1|446379_446715_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004266244.1|447186_448086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|448184_448400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198711.1|448775_448967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555731.1|448993_449656_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162490682.1|449889_451605_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.8	3.9e-26
WP_004200833.1|451597_452500_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004199315.1|452622_453621_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533171.1|453721_454672_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP009738	Burkholderia mallei strain Turkey7 chromosome 2, complete sequence	2146721	530060	587069	2146721	transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_004191998.1|530060_531524_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004551552.1|531726_532563_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|532562_533057_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|533238_534078_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|534327_535368_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	23.5	2.4e-10
WP_004200943.1|535735_536881_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|537069_538278_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|538682_539459_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|539474_540344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|541187_542603_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|543198_543441_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|543591_543882_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	37.8	4.4e-07
WP_024901083.1|544275_545592_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|546013_546511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|546628_547513_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|547623_548744_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|549765_551820_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|552079_552535_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|552531_553386_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|553433_554780_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|555181_556291_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|556528_557611_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|557667_558765_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|558742_559690_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|559679_560540_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|560583_561855_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|561851_563306_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|563310_563862_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_073699529.1|564301_564418_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|570015_571136_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198117.1|571306_571453_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|571577_573041_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|573249_573528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|573540_574386_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|574534_575506_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004266709.1|575693_576482_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|576686_578150_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|578293_579493_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|579780_581871_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|582094_582646_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|582705_583035_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|583094_583937_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|583933_585334_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|585393_585804_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802333.1|585949_587069_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009738	Burkholderia mallei strain Turkey7 chromosome 2, complete sequence	2146721	1659901	1734599	2146721	tRNA,plate,transposase	Leptospira_phage(23.08%)	59	NA	NA
WP_004203245.1|1659901_1660714_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1660713_1663341_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1663476_1664598_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1664596_1664758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1664939_1666007_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1666055_1666706_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1666783_1666933_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1666929_1668339_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1668730_1670026_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1670018_1670966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1671685_1672213_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1672373_1675097_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1675348_1676593_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1677804_1678924_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200651.1|1678935_1679079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187842.1|1679154_1680129_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004188362.1|1680225_1681527_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004188825.1|1681579_1681852_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004187935.1|1681853_1682555_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188402.1|1682576_1684352_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187439.1|1684356_1684725_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004536542.1|1684729_1685146_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004196014.1|1685345_1686155_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187735.1|1686444_1687428_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188261.1|1687625_1688645_+	lyase	NA	NA	NA	NA	NA
WP_004188791.1|1688801_1689311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188028.1|1689387_1690839_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004187807.1|1690886_1693604_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004187717.1|1693850_1696568_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.2	2.0e-13
WP_004188259.1|1696668_1698333_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004204352.1|1698356_1698629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1698924_1700044_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1701476_1702736_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_004190781.1|1702836_1703883_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1703957_1705058_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_004200631.1|1705166_1706696_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.2e-12
WP_004196164.1|1707790_1708816_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1709166_1711404_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1711491_1711887_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1712047_1712584_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1712852_1713488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1713618_1714383_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190911.1|1714661_1714973_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1715417_1715750_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1715948_1717364_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1717352_1717496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1717819_1718497_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1718459_1719398_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1719394_1720819_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1721335_1722316_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1722328_1723090_+	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	34.4	1.2e-16
WP_038802950.1|1722989_1724109_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196154.1|1724137_1725196_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1725125_1725779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1725853_1728058_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1728054_1730709_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004190820.1|1730687_1732166_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1732162_1734034_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1734038_1734599_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009738	Burkholderia mallei strain Turkey7 chromosome 2, complete sequence	2146721	1810217	1869580	2146721	tRNA,integrase,transposase,portal	Leptospira_phage(22.22%)	53	1801933:1801992	1864266:1865216
1801933:1801992	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_011204325.1|1810217_1811258_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1811648_1812458_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004266656.1|1812608_1814513_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004190235.1|1814596_1815481_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1815477_1815771_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1816040_1817147_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004191998.1|1817297_1818761_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190656.1|1818885_1819755_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1819813_1820689_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|1820841_1821063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763983.1|1821402_1823196_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1823550_1824933_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190446.1|1825251_1828032_-	DNA polymerase I	NA	A0A1J0GVZ7	Streptomyces_phage	31.0	5.6e-51
WP_004530319.1|1828033_1828783_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1828779_1829049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190916.1|1829200_1829485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1830144_1830636_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004203322.1|1831071_1831335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1833239_1834359_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950031.1|1834916_1835204_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004195697.1|1835200_1835887_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_004190957.1|1835970_1837497_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004190726.1|1837652_1838051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1838144_1839140_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004190835.1|1839130_1839943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730270.1|1840074_1840326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190487.1|1840445_1840898_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832128.1|1841035_1841455_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190391.1|1841567_1841726_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190691.1|1841822_1842971_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004204469.1|1843221_1843920_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195689.1|1844360_1845161_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190258.1|1845173_1845848_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190506.1|1845849_1846551_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190826.1|1847094_1847943_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004195687.1|1847977_1849900_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190990.1|1850097_1850481_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_004190343.1|1850578_1851454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190540.1|1851520_1852441_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1852533_1853313_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190954.1|1853398_1854739_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190469.1|1854735_1855365_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190582.1|1855523_1857167_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190434.1|1858451_1858907_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190743.1|1858971_1860210_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004195676.1|1860462_1860873_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190802.1|1861114_1861708_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004533441.1|1861803_1862658_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195671.1|1862888_1863215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190721.1|1863397_1864285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1864312_1865433_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1864266:1865216	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCA	NA	NA	NA	NA
WP_004190833.1|1865498_1866578_-	putative membrane protein	NA	NA	NA	NA	NA
WP_004190269.1|1868575_1869580_-|transposase	transposase	transposase	NA	NA	NA	NA
