The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	405389	442969	3625848	holin,plate,transposase	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405389_406853_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406986_408051_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408296_408965_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409058_409610_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409803_410664_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411731_412112_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412143_414447_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414477_415005_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415045_417067_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417070_418018_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|418014_418719_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418715_419819_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420167_420563_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420564_421293_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421490_421994_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422016_423267_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423453_423954_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424661_425867_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425863_427966_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427946_428486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428581_429706_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429698_430511_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430532_431267_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431620_433042_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433205_433559_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433576_434407_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434590_436081_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436177_436870_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438245_439365_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439504_439987_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440066_441905_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441868_442969_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	542516	595136	3625848	protease,portal,terminase,transposase	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542516_543038_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543259_543757_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543753_544809_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544852_545209_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545211_545508_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546315_547435_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548060_548333_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548451_549234_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549553_549982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550063_550939_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550931_551453_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551610_552624_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552707_553505_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553532_554381_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554458_555838_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555848_556526_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556815_557976_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|558011_558194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558448_560464_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560504_563534_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564071_565172_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565571_566531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566653_567385_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567757_568480_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568476_569526_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569522_570401_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570405_571665_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571881_573387_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573442_573835_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573845_574655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574700_575498_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575582_577232_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577959_578301_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579474_580594_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581017_581323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581346_582333_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582362_583199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583657_584845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584843_585980_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586586_587792_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587804_589928_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590291_591425_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591501_592068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592403_592859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593423_593864_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593850_593988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594015_595136_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	1276426	1285663	3625848		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1276426_1278379_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1278645_1279776_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1279809_1281816_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1281991_1282807_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1282871_1283555_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1283551_1284079_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1284115_1285663_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	1289153	1367096	3625848	protease,transposase,tRNA	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1289153_1290128_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1290124_1292179_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1292363_1293044_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1293364_1294192_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1294302_1295139_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1295409_1296837_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1297234_1298971_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1299250_1300402_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1300582_1301746_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1301827_1303375_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1303381_1304164_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1304160_1304817_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1304849_1306373_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1306395_1307718_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1307817_1308669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1308665_1310462_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1310479_1311415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1311411_1312254_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1312263_1313277_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1313292_1314333_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1314329_1314908_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1314909_1315602_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1315598_1316168_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1316434_1317637_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1317633_1318422_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1318423_1319956_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1319958_1327599_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1327595_1328513_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1328577_1329897_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1329905_1330598_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1331573_1332693_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1332767_1332986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1333183_1333693_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1333993_1336108_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1337280_1338744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1339288_1340134_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1340302_1341049_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1341764_1343126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1343098_1343434_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1343730_1345170_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1345517_1345805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1345788_1347063_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1347187_1347793_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1348324_1349347_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1349362_1349890_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1349974_1350730_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1350963_1352169_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1352257_1353378_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1354440_1355019_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1355215_1356598_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1356592_1356823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1357055_1358084_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1358064_1358271_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1358444_1359236_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1359444_1360107_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1360242_1361706_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1361809_1362013_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1362545_1362860_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1362856_1365157_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1365975_1367096_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	1963404	2033519	3625848	coat,plate,transposase	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1963404_1964524_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1964569_1965160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1965501_1966008_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1966004_1966430_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1967175_1969068_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1969134_1970595_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1970817_1971195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1971218_1971797_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1972011_1974804_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1974800_1977023_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1977019_1978762_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1978788_1980897_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1983158_1986554_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1986550_1989898_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1990221_1990476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1990451_1991930_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1992112_1992403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1992637_1992856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473477.1|1993351_1993645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1993827_1994151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1994434_1995859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1996125_1997103_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1997516_1998299_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1998482_1998698_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1998708_1999080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1999131_1999467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1999549_1999708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|2000073_2000769_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|2001156_2004429_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|2004509_2005220_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|2005221_2006751_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|2006767_2007112_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|2007534_2007777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|2007822_2008383_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|2008417_2008906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|2008932_2011335_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|2011587_2011821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|2011865_2012702_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|2012871_2013000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053811246.1|2013993_2015844_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|2015871_2017287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|2017310_2017577_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|2017836_2018064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|2018097_2020905_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|2020907_2021741_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|2021974_2023095_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|2023830_2025144_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|2026038_2026308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|2026560_2026842_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|2027309_2028302_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|2028346_2029543_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|2030049_2030943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|2031280_2031502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|2031587_2031773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|2031759_2032305_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2032357_2032918_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|2032994_2033519_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	2096622	2167855	3625848	transposase,tRNA	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|2096622_2099490_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|2099629_2101993_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|2101989_2102778_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|2103099_2104350_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|2104701_2106378_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|2106725_2107607_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|2107620_2107824_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|2107820_2110022_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024901066.1|2110038_2111814_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|2111986_2112928_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|2113271_2114255_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|2114286_2115708_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|2115742_2116192_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|2116188_2116797_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|2116902_2118213_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|2118384_2118705_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|2118921_2119386_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|2119485_2121300_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|2121311_2121416_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|2121780_2122890_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|2123055_2123589_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|2123588_2124002_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|2124046_2125167_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2125254_2126430_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2126554_2128927_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2129095_2129344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2130349_2131900_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2131949_2133215_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2133365_2135045_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2135288_2135750_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2135986_2136397_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2136591_2137689_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2137795_2139226_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2139325_2140600_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2140727_2143592_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2143930_2145757_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2145709_2145850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2146049_2146547_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2146646_2148143_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2148210_2149446_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2149468_2151028_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2151298_2152234_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2152260_2152629_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2152734_2155662_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2155753_2157229_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2157225_2157687_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2157991_2159656_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2159719_2161048_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2161466_2162369_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2162787_2163189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2163394_2163652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2163810_2164128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2164328_2165051_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2165289_2165568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2165716_2165974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2166023_2166314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2166735_2167855_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	2847777	2927023	3625848	protease,transposase,tRNA	Streptococcus_phage(26.67%)	60	NA	NA
WP_004192783.1|2847777_2849304_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	2.8e-84
WP_004193508.1|2849671_2850397_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_004192531.1|2850810_2851020_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004193872.1|2851038_2851380_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004193590.1|2851472_2853341_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	7.3e-103
WP_004202016.1|2853406_2853934_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_004191333.1|2854046_2854370_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	8.9e-25
WP_004192918.1|2854452_2854860_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	78.0	1.2e-50
WP_004192952.1|2854925_2856149_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_004195928.1|2856217_2856757_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_004557108.1|2856858_2857338_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_004193107.1|2857429_2857639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191338.1|2857800_2859252_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_004193278.1|2859400_2860123_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004191360.1|2860305_2861118_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2861246_2862710_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2862818_2863388_-	phasin family protein	NA	NA	NA	NA	NA
WP_004191998.1|2865297_2866761_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2867017_2868787_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2869094_2870684_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2870816_2873513_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2873644_2873866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2873785_2876296_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2876292_2876931_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2877247_2878105_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004191126.1|2878782_2880882_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2881111_2882314_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2882266_2882551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2883036_2884317_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2884360_2885746_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2885996_2889722_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2889718_2891272_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2891268_2891973_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2892009_2892696_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2892837_2894760_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2894795_2895497_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2895643_2896420_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2896702_2898166_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2898299_2899835_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2899872_2901015_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2901181_2902597_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2903001_2903466_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2903718_2904537_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2904533_2905367_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2905910_2906900_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2906916_2907909_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2908010_2912138_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2912161_2913538_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2913590_2913866_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2914038_2915370_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2915578_2917105_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2917101_2918895_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2919003_2919906_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2920307_2921771_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2921887_2922454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2922597_2923718_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2923827_2924304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2924760_2924985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2925249_2926386_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2926483_2927023_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	3158262	3222176	3625848	protease,transposase	Leptospira_phage(25.0%)	60	NA	NA
WP_004192020.1|3158262_3159771_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3159787_3160840_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3160845_3161448_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3161531_3162131_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3162236_3162710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3162721_3163960_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3164116_3164356_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3164499_3165249_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3165299_3166232_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3166302_3167292_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3167291_3168398_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3168536_3168716_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3168812_3169445_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3169688_3170336_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3170332_3171055_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3171093_3172095_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3172104_3172500_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3172797_3173805_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192715.1|3174568_3177841_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_004532083.1|3177980_3179093_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3179126_3179750_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3179861_3181172_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3181208_3181496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3181492_3181996_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3182238_3183714_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3183710_3184700_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3184765_3186208_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3186263_3186926_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3187070_3188270_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3188354_3188621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3188538_3188862_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3189349_3189829_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3190426_3191215_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3191399_3191906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3192243_3192465_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3192589_3193996_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3194313_3195433_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3195629_3195803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3195817_3197212_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3197690_3198197_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004197804.1|3198384_3198579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3199142_3199853_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3202691_3204155_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3204312_3205923_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3205935_3206118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3206090_3207350_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3207617_3208196_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3208389_3209510_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3210621_3211742_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197797.1|3212168_3212327_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_011203825.1|3212323_3212917_-	chorismate mutase	NA	NA	NA	NA	NA
WP_004189159.1|3213529_3213919_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004188913.1|3214065_3216402_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189437.1|3216410_3217661_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004203540.1|3217657_3218146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|3218432_3218684_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004197793.1|3219383_3219599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3219854_3220331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3220353_3220614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3220955_3222176_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	3275053	3283895	3625848		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3275053_3276454_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3276422_3277409_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3277467_3278460_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3278531_3278849_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3279172_3280075_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3280300_3281608_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3281786_3282710_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3283052_3283895_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009731	Burkholderia mallei strain Turkey4 chromosome 1, complete sequence	3625848	3545038	3602563	3625848	protease,portal,tRNA,transposase	Vibrio_phage(17.65%)	50	NA	NA
WP_004191998.1|3545038_3546502_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3546668_3547439_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3547470_3548310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3548436_3549909_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3549911_3551402_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3551514_3551814_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_053811204.1|3552179_3553223_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3553342_3554416_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3554412_3554925_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3555108_3557517_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3557528_3558677_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3559027_3559804_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3559800_3560586_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3561007_3561460_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3561479_3562112_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3562205_3562940_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3563407_3564091_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3564091_3566500_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3566501_3567092_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3567088_3568498_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3568867_3569725_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3569834_3570470_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3570590_3571574_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3571605_3572109_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3572337_3573528_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3573587_3573959_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3574169_3576779_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3577000_3578056_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3578505_3579522_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3579642_3580512_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3580549_3580954_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3581344_3582565_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_038802950.1|3583881_3585001_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3585053_3585536_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3585532_3585817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3585889_3586981_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3587379_3587790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3587926_3588802_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3588812_3589925_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3589953_3591048_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|3591190_3592159_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|3592261_3592831_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3593423_3593972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3594235_3595684_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3595702_3597316_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3597475_3598417_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3598413_3599508_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3599909_3600326_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3600511_3601066_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3601443_3602563_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009732	Burkholderia mallei strain Turkey4 chromosome 2, complete sequence	2106749	171065	214792	2106749	plate,transposase	Streptococcus_phage(40.0%)	29	NA	NA
WP_004191998.1|171065_172529_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004554722.1|172667_173567_-	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196258.1|173730_174978_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004188170.1|175130_176063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188660.1|176607_177348_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004202300.1|177367_177652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|177791_178157_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004196252.1|178598_180515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|180726_183687_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011204674.1|183714_183945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|184251_185472_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004188150.1|185601_186660_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187705.1|187585_189070_+	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004187879.1|189115_190984_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	23.1	1.9e-18
WP_004187502.1|191012_191984_+	quinone oxidoreductase	NA	A0A2P1ELD9	Moumouvirus	25.2	6.6e-07
WP_004187006.1|192038_192965_+	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004196246.1|193207_194554_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188288.1|195139_195370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188530.1|199493_200759_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188743.1|200847_202194_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004187276.1|202215_202719_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188308.1|202825_203311_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004188012.1|203427_204927_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196243.1|204961_205543_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011204222.1|207700_209164_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004188539.1|210595_211342_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187921.1|211338_212304_+	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004187068.1|212290_212872_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187986.1|212902_214792_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009732	Burkholderia mallei strain Turkey4 chromosome 2, complete sequence	2106749	383909	454693	2106749	tRNA,transposase,holin	Acinetobacter_phage(45.45%)	58	NA	NA
WP_004521984.1|383909_385208_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004200645.1|385499_385811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198580.1|385807_386062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186938.1|386080_387895_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.6	3.0e-170
WP_004186966.1|388031_388583_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004186915.1|388579_389203_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004186903.1|389538_391206_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.2	2.2e-42
WP_004186876.1|391492_391804_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004202137.1|391943_392921_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_004198399.1|393036_393516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186796.1|393673_393895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186864.1|394178_395582_+	GABA permease	NA	NA	NA	NA	NA
WP_004186854.1|395653_396487_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186860.1|396500_397004_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_004206632.1|397218_397500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186874.1|397610_398705_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004186799.1|399230_399596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557275.1|399604_399961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266669.1|400052_400181_-	lipoprotein	NA	NA	NA	NA	NA
WP_004521997.1|400495_401677_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_004186871.1|401778_402507_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004186839.1|402606_404436_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_004549943.1|404574_405171_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004186801.1|405390_406170_-	uracil-DNA glycosylase	NA	A0A060Q589	Fruit_bat_alphaherpesvirus	51.1	6.4e-53
WP_004186832.1|406211_406853_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_004186826.1|406863_407649_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	9.3e-52
WP_004186823.1|407711_408743_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.6e-80
WP_004186792.1|408760_409351_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.0	1.4e-68
WP_004186866.1|409364_410858_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_004186872.1|411220_411949_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_004186923.1|411945_412641_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_004522004.1|412687_412897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186878.1|412822_413197_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_038719768.1|413305_414532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186945.1|414859_416158_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_004186957.1|416671_417463_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_004522007.1|417521_418724_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004186941.1|418812_420519_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_004198410.1|420649_421426_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_073699529.1|421822_421939_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_096325434.1|427557_428677_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|428918_430379_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_009967729.1|431957_432890_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011326545.1|433333_434023_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.8	2.2e-12
WP_024900894.1|434054_434789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|442583_443704_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004266245.1|444262_445333_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004184680.1|445395_445890_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.6	2.5e-26
WP_004184724.1|445924_446404_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004198701.1|446400_446736_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004266244.1|447207_448107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|448205_448421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198711.1|448796_448988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555731.1|449014_449677_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162490682.1|449910_451626_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.8	3.9e-26
WP_004200833.1|451618_452521_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004199315.1|452643_453642_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533171.1|453742_454693_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP009732	Burkholderia mallei strain Turkey4 chromosome 2, complete sequence	2106749	594621	651630	2106749	transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_004191998.1|594621_596085_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004551552.1|596287_597124_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200939.1|597123_597618_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|597799_598639_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|598888_599929_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	23.5	2.4e-10
WP_004200943.1|600296_601442_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|601630_602839_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|603243_604020_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|604035_604905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|605748_607164_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|607759_608002_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|608152_608443_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	37.8	4.4e-07
WP_024901083.1|608836_610153_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|610574_611072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|611189_612074_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|612184_613305_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|614326_616381_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|616640_617096_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|617092_617947_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|617994_619341_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|619742_620852_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|621089_622172_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|622228_623326_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|623303_624251_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|624240_625101_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|625144_626416_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|626412_627867_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|627871_628423_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_073699529.1|628862_628979_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|634576_635697_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198117.1|635867_636014_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|636138_637602_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|637810_638089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|638101_638947_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|639095_640067_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004266709.1|640254_641043_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|641247_642711_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|642854_644054_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|644341_646432_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|646655_647207_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|647266_647596_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|647655_648498_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|648494_649895_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|649954_650365_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802333.1|650510_651630_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009732	Burkholderia mallei strain Turkey4 chromosome 2, complete sequence	2106749	1618703	1693401	2106749	plate,tRNA,transposase	Leptospira_phage(23.08%)	59	NA	NA
WP_004203245.1|1618703_1619516_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004203246.1|1619515_1622143_-	membrane protein	NA	NA	NA	NA	NA
WP_004188178.1|1622278_1623400_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004525190.1|1623398_1623560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187693.1|1623741_1624809_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_004187882.1|1624857_1625508_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_004187125.1|1625585_1625735_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004187091.1|1625731_1627141_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004187288.1|1627532_1628828_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187652.1|1628820_1629768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187998.1|1630487_1631015_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187349.1|1631175_1633899_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_004188364.1|1634150_1635395_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1636606_1637726_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200651.1|1637737_1637881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187842.1|1637956_1638931_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004188362.1|1639027_1640329_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004188825.1|1640381_1640654_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_004187935.1|1640655_1641357_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004188402.1|1641378_1643154_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_004187439.1|1643158_1643527_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_004536542.1|1643531_1643948_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004196014.1|1644147_1644957_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187735.1|1645246_1646230_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004188261.1|1646427_1647447_+	lyase	NA	NA	NA	NA	NA
WP_004188791.1|1647603_1648113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188028.1|1648189_1649641_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_004187807.1|1649688_1652406_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_004187717.1|1652652_1655370_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.2	2.0e-13
WP_004188259.1|1655470_1657135_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004204352.1|1657158_1657431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1657726_1658846_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1660278_1661538_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_004190781.1|1661638_1662685_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1662759_1663860_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_004200631.1|1663968_1665498_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.2e-12
WP_004196164.1|1666592_1667618_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1667968_1670206_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1670293_1670689_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1670849_1671386_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1671654_1672290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1672420_1673185_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190911.1|1673463_1673775_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1674219_1674552_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1674750_1676166_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1676154_1676298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1676621_1677299_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1677261_1678200_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1678196_1679621_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1680137_1681118_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1681130_1681892_+	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	34.4	1.2e-16
WP_038802950.1|1681791_1682911_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196154.1|1682939_1683998_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1683927_1684581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1684655_1686860_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004203276.1|1686856_1689511_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004190820.1|1689489_1690968_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1690964_1692836_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1692840_1693401_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009732	Burkholderia mallei strain Turkey4 chromosome 2, complete sequence	2106749	1769009	1828379	2106749	integrase,tRNA,transposase,portal	Leptospira_phage(22.22%)	53	1760725:1760784	1823065:1824015
1760725:1760784	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_011204325.1|1769009_1770050_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1770440_1771250_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004266656.1|1771400_1773305_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004190235.1|1773388_1774273_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1774269_1774563_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1774832_1775939_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004191998.1|1776089_1777553_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190656.1|1777677_1778547_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1778605_1779481_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|1779633_1779855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038763983.1|1780194_1781988_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1782349_1783732_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190446.1|1784050_1786831_-	DNA polymerase I	NA	A0A1J0GVZ7	Streptomyces_phage	31.0	5.6e-51
WP_004530319.1|1786832_1787582_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1787578_1787848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190916.1|1787999_1788284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|1788943_1789435_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004203322.1|1789870_1790134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|1792038_1793158_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009950031.1|1793715_1794003_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004195697.1|1793999_1794686_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_004190957.1|1794769_1796296_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004190726.1|1796451_1796850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|1796943_1797939_+	homoserine kinase	NA	NA	NA	NA	NA
WP_004190835.1|1797929_1798742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038730270.1|1798873_1799125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190487.1|1799244_1799697_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011832128.1|1799834_1800254_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190391.1|1800366_1800525_-	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190691.1|1800621_1801770_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004204469.1|1802020_1802719_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004195689.1|1803159_1803960_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190258.1|1803972_1804647_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004190506.1|1804648_1805350_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190826.1|1805893_1806742_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004195687.1|1806776_1808699_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190990.1|1808896_1809280_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_004190343.1|1809377_1810253_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190540.1|1810319_1811240_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004190659.1|1811332_1812112_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190954.1|1812197_1813538_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190469.1|1813534_1814164_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190582.1|1814322_1815966_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190434.1|1817250_1817706_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190743.1|1817770_1819009_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004195676.1|1819261_1819672_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190802.1|1819913_1820507_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004533441.1|1820602_1821457_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195671.1|1821687_1822014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190721.1|1822196_1823084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|1823111_1824232_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1823065:1824015	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCA	NA	NA	NA	NA
WP_004190833.1|1824297_1825377_-	putative membrane protein	NA	NA	NA	NA	NA
WP_004190269.1|1827374_1828379_-|transposase	transposase	transposase	NA	NA	NA	NA
