The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	405381	442961	3471563	holin,transposase,plate	Streptococcus_phage(20.0%)	32	NA	NA
WP_004191998.1|405381_406845_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198200.1|406978_408043_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011807805.1|408288_408957_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_004198198.1|409050_409602_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_004198197.1|409795_410656_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004198195.1|411723_412104_+	response regulator	NA	NA	NA	NA	NA
WP_011204177.1|412135_414439_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_004199265.1|414469_414997_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_004202799.1|415037_417059_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	2.2e-12
WP_011832274.1|417062_418010_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
WP_004198646.1|418006_418711_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_004200023.1|418707_419811_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004185006.1|420159_420555_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	2.7e-07
WP_004524402.1|420556_421285_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_004198643.1|421482_421986_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004198642.1|422008_423259_+	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004198641.1|423445_423946_+	VOC family protein	NA	NA	NA	NA	NA
WP_004198640.1|424653_425859_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_004198639.1|425855_427958_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_123784499.1|427938_428478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198638.1|428573_429698_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_004198637.1|429690_430503_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_004198636.1|430524_431259_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_004198634.1|431612_433034_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	7.6e-44
WP_004198632.1|433197_433551_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|433568_434399_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_038798086.1|434582_436073_-	6-aminohexanoate hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|436169_436862_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|438237_439357_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|439496_439979_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|440058_441897_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|441860_442961_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	542508	595128	3471563	terminase,transposase,protease,portal	Leptospira_phage(20.0%)	47	NA	NA
WP_004199890.1|542508_543030_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|543251_543749_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|543745_544801_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|544844_545201_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|545203_545500_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|546307_547427_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199882.1|548052_548325_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_004201278.1|548443_549226_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199881.1|549545_549974_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|550055_550931_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199879.1|550923_551445_+	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004202867.1|551602_552616_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199877.1|552699_553497_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004201276.1|553524_554373_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004197153.1|554450_555830_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004197150.1|555840_556518_+	response regulator	NA	NA	NA	NA	NA
WP_004197145.1|556807_557968_+	porin	NA	NA	NA	NA	NA
WP_004197141.1|558003_558186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901007.1|558440_560456_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.8	2.5e-85
WP_004197137.1|560496_563526_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197133.1|564063_565164_+	porin	NA	NA	NA	NA	NA
WP_004199873.1|565563_566523_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004538585.1|566645_567377_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004197129.1|567749_568472_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004197128.1|568468_569518_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197127.1|569514_570393_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197126.1|570397_571657_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198383.1|571873_573379_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004198382.1|573434_573827_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198380.1|573837_574647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198379.1|574692_575490_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198377.1|575574_577224_-	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198376.1|577951_578293_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|579466_580586_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004525798.1|581009_581315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202848.1|581338_582325_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_004202847.1|582354_583191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160468978.1|583649_584837_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004202842.1|584835_585972_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004202841.1|586578_587784_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_004202840.1|587796_589920_+	fatty oxidation complex subunit alpha	NA	NA	NA	NA	NA
WP_004202838.1|590283_591417_+	CoA transferase	NA	NA	NA	NA	NA
WP_004525805.1|591493_592060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202836.1|592395_592851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935860.1|593415_593856_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_004202832.1|593842_593980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|594007_595128_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	1146558	1155795	3471563		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1146558_1148511_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_024901038.1|1148777_1149908_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1149941_1151948_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1152123_1152939_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1153003_1153687_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1153683_1154211_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194112.1|1154247_1155795_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	1159285	1237227	3471563	tRNA,transposase,protease	Synechococcus_phage(15.0%)	60	NA	NA
WP_004194103.1|1159285_1160260_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004194266.1|1160256_1162311_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.7	2.9e-76
WP_004194375.1|1162495_1163176_+	membrane protein	NA	NA	NA	NA	NA
WP_004194228.1|1163496_1164324_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024901039.1|1164434_1165271_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_004194323.1|1165541_1166969_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	1.3e-54
WP_004194028.1|1167366_1169103_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004196472.1|1169382_1170534_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004194378.1|1170714_1171878_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024901040.1|1171959_1173507_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_004194135.1|1173513_1174296_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004194035.1|1174292_1174949_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.1	8.7e-11
WP_004194357.1|1174981_1176505_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024900377.1|1176527_1177850_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_004196467.1|1177949_1178801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194348.1|1178797_1180594_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
WP_004541333.1|1180611_1181547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194206.1|1181543_1182386_+	sugar nucleotide-binding protein	NA	A0A222YYW2	Synechococcus_phage	35.0	1.7e-38
WP_004194087.1|1182395_1183409_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	52.6	7.2e-97
WP_004194045.1|1183424_1184465_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	40.5	1.7e-61
WP_004200490.1|1184461_1185040_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	37.2	2.5e-17
WP_004194086.1|1185041_1185734_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	28.8	7.5e-05
WP_004194255.1|1185730_1186300_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024901041.1|1186566_1187769_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_004194054.1|1187765_1188554_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194306.1|1188555_1190088_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_004202217.1|1190090_1197731_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004194036.1|1197727_1198645_+	UDP-3-O-acyl N-acetylglycosamine deacetylase	NA	NA	NA	NA	NA
WP_004194209.1|1198709_1200029_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004194345.1|1200037_1200730_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038802950.1|1201705_1202825_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|1202899_1203118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|1203315_1203825_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|1204125_1206240_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_024901034.1|1207412_1208876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|1209420_1210266_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|1210434_1211181_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|1211896_1213258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|1213230_1213566_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|1213862_1215302_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|1215649_1215937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|1215920_1217195_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|1217319_1217925_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|1218456_1219479_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|1219494_1220022_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|1220106_1220862_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|1221095_1222301_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325437.1|1222389_1223510_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|1224572_1225151_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|1225347_1226730_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|1226724_1226955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|1227187_1228216_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|1228196_1228403_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|1228576_1229368_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|1229576_1230239_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|1230373_1231837_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|1231940_1232144_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|1232676_1232991_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|1232987_1235288_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_038802950.1|1236106_1237227_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	1833640	1903755	3471563	transposase,coat,plate	Leptospira_phage(28.57%)	57	NA	NA
WP_038802950.1|1833640_1834760_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699268.1|1834805_1835396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193369.1|1835737_1836244_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004191223.1|1836240_1836666_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.3e-15
WP_004193964.1|1837411_1839304_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191686.1|1839370_1840831_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004197687.1|1841053_1841431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024901063.1|1841454_1842033_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_004197691.1|1842247_1845040_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_004266861.1|1845036_1847259_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_004191214.1|1847255_1848998_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_004192927.1|1849024_1851133_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_004205216.1|1853394_1856790_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011832205.1|1856786_1860134_-	alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
WP_004205215.1|1860457_1860712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193933.1|1860687_1862166_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004193830.1|1862348_1862639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1862873_1863092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162473477.1|1863587_1863881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1864063_1864387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193478.1|1864670_1866095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193589.1|1866361_1867339_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526732.1|1867752_1868535_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1868718_1868934_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004192564.1|1868944_1869316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1869367_1869703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191937.1|1869785_1869944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1870309_1871005_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004191391.1|1871392_1874665_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004191672.1|1874745_1875456_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004192726.1|1875457_1876987_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	1.2e-15
WP_004191318.1|1877003_1877348_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004193132.1|1877770_1878013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1878058_1878619_-	SCO family protein	NA	NA	NA	NA	NA
WP_004191878.1|1878653_1879142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196681.1|1879168_1881571_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004196682.1|1881823_1882057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266855.1|1882101_1882938_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1883107_1883236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192127.1|1884229_1886080_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004193292.1|1886107_1887523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1887546_1887813_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004192367.1|1888072_1888300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191109.1|1888333_1891141_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	6.8e-28
WP_004192570.1|1891143_1891977_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1892210_1893331_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193170.1|1894066_1895380_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004191144.1|1896274_1896544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1896796_1897078_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004192394.1|1897545_1898538_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004196700.1|1898582_1899779_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|1900285_1901179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004531175.1|1901516_1901738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542449.1|1901823_1902009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192149.1|1901995_1902541_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|1902593_1903154_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1903230_1903755_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	1966858	2038081	3471563	tRNA,transposase	Bacillus_phage(15.38%)	57	NA	NA
WP_004191922.1|1966858_1969726_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192721.1|1969865_1972229_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	30.6	4.2e-71
WP_004193777.1|1972225_1973014_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004192717.1|1973335_1974586_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196082.1|1974937_1976614_+	chemotaxis methyl-accepting membrane protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	3.9e-15
WP_004191342.1|1976961_1977843_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004191885.1|1977856_1978060_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004192976.1|1978056_1980258_-	FUSC family protein	NA	NA	NA	NA	NA
WP_024900385.1|1980274_1982041_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004191155.1|1982213_1983155_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192873.1|1983498_1984482_-	ser/threonine protein phosphatase	NA	S4VP02	Pandoravirus	34.0	1.8e-20
WP_004191226.1|1984513_1985935_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004192580.1|1985969_1986419_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_004193704.1|1986415_1987024_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004266851.1|1987129_1988440_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_004192500.1|1988611_1988932_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004193328.1|1989148_1989613_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_004196088.1|1989712_1991527_+	MFS transporter	NA	NA	NA	NA	NA
WP_125754530.1|1991538_1991643_+	MFS transporter	NA	NA	NA	NA	NA
WP_004266572.1|1992007_1993117_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	1.1e-82
WP_004521230.1|1993282_1993816_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900959.1|1993815_1994229_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.0	5.8e-29
WP_038802950.1|1994273_1995394_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|1995481_1996657_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|1996781_1999154_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|1999322_1999571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011857895.1|2000575_2002126_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|2002175_2003441_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2003591_2005271_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004193599.1|2005514_2005976_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|2006212_2006623_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004550551.1|2006817_2007915_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191219.1|2008021_2009452_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004192735.1|2009551_2010826_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191889.1|2010953_2013818_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004193111.1|2014156_2015983_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191941.1|2015935_2016076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192835.1|2016275_2016773_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191557.1|2016872_2018369_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192058.1|2018436_2019672_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|2019694_2021254_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|2021524_2022460_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|2022486_2022855_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004197388.1|2022960_2025888_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004193517.1|2025979_2027455_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|2027451_2027913_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004191876.1|2028217_2029882_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004192767.1|2029945_2031274_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004193481.1|2031692_2032595_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|2033013_2033415_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004521676.1|2033620_2033878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199444.1|2034036_2034354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2034554_2035277_+	YdcF family protein	NA	NA	NA	NA	NA
WP_004192834.1|2035515_2035794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2035942_2036200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193694.1|2036249_2036540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2036961_2038081_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	2717976	2797229	3471563	tRNA,transposase,protease	Streptococcus_phage(28.57%)	60	NA	NA
WP_004192783.1|2717976_2719503_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	2.8e-84
WP_004193508.1|2719870_2720596_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_004192531.1|2721009_2721219_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004193872.1|2721237_2721579_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004193590.1|2721671_2723540_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.7	7.3e-103
WP_004202016.1|2723605_2724133_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_004191333.1|2724245_2724569_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	8.9e-25
WP_004192918.1|2724651_2725059_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	78.0	1.2e-50
WP_004192952.1|2725124_2726348_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_004195928.1|2726416_2726956_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_004557108.1|2727057_2727537_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_004193107.1|2727628_2727838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191338.1|2727999_2729451_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_004193278.1|2729599_2730322_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004191360.1|2730504_2731317_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2731445_2732909_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2733017_2733587_-	phasin family protein	NA	NA	NA	NA	NA
WP_004191998.1|2735496_2736960_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2737216_2738986_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_004193075.1|2739293_2740883_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2741015_2743712_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2743843_2744065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2743984_2746495_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2746491_2747130_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2747446_2748304_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004199570.1|2748260_2748476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2748989_2751089_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2751318_2752521_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2752473_2752758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2753243_2754524_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2754567_2755953_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2756203_2759929_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2759925_2761479_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2761475_2762180_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2762216_2762903_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2763044_2764967_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2765002_2765704_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2765850_2766627_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2766909_2768373_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2768506_2770042_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2770079_2771222_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004192601.1|2771388_2772804_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2773208_2773673_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2773925_2774744_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2774740_2775574_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2776117_2777107_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2777123_2778116_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004192168.1|2782367_2783744_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2783796_2784072_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2784244_2785576_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_004199573.1|2785784_2787311_-	CoA transferase	NA	NA	NA	NA	NA
WP_004193195.1|2787307_2789101_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2789209_2790112_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|2790513_2791977_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_011832359.1|2792093_2792660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2792803_2793924_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2794033_2794510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2794966_2795191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2795455_2796592_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2796689_2797229_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	3028585	3085441	3471563	transposase,protease	Leptospira_phage(25.0%)	52	NA	NA
WP_004192020.1|3028585_3030094_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004192760.1|3030110_3031163_-	sugar dehydratase	NA	NA	NA	NA	NA
WP_004192486.1|3031168_3031771_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_004193971.1|3031854_3032454_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.3	3.8e-05
WP_004192146.1|3032559_3033033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024901020.1|3033044_3034283_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_004197638.1|3034439_3034679_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.6e-10
WP_004197597.1|3034822_3035572_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	5.8e-19
WP_004193828.1|3035622_3036555_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_004191537.1|3036625_3037615_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004192749.1|3037614_3038721_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004192741.1|3038859_3039039_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004193919.1|3039135_3039768_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004192535.1|3040011_3040659_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004193677.1|3040655_3041378_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191725.1|3041416_3042418_-	S49 family peptidase	NA	NA	NA	NA	NA
WP_004193415.1|3042427_3042823_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004193798.1|3043120_3044128_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004532083.1|3048301_3049414_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004192903.1|3049447_3050071_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004191191.1|3050182_3051493_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_004192965.1|3051529_3051817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199373.1|3051813_3052317_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193862.1|3052559_3054035_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_011203830.1|3054031_3055021_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	25.8	4.1e-12
WP_004193636.1|3055086_3056529_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004192015.1|3056584_3057247_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_004202995.1|3057391_3058591_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	34.7	1.2e-55
WP_004193394.1|3058675_3058942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004205776.1|3058859_3059183_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_004197812.1|3059670_3060150_+	protein CreA	NA	NA	NA	NA	NA
WP_004536352.1|3060740_3061529_+	DUF4088 family protein	NA	NA	NA	NA	NA
WP_004189585.1|3061713_3062220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189709.1|3062557_3062779_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_004189199.1|3062903_3064310_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|3064627_3065747_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197806.1|3065943_3066117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189867.1|3066131_3067526_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004190145.1|3068004_3068511_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004197804.1|3068698_3068893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189917.1|3069456_3070167_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004191998.1|3073005_3074469_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189292.1|3074626_3076237_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3076249_3076432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3076404_3077664_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3077931_3078510_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_096325434.1|3078703_3079824_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_096325434.1|3080935_3082056_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197793.1|3082648_3082864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3083119_3083596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190100.1|3083618_3083879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|3084220_3085441_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 9
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	3138318	3147160	3471563		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|3138318_3139719_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|3139687_3140674_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|3140732_3141725_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|3141796_3142114_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|3142437_3143340_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_024901052.1|3143565_3144873_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|3145051_3145975_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|3146317_3147160_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 10
NZ_CP009725	Burkholderia mallei strain Turkey1 chromosome 1, complete sequence	3471563	3408299	3465838	3471563	tRNA,transposase,protease,portal	Vibrio_phage(17.65%)	51	NA	NA
WP_004191998.1|3408299_3409763_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3409929_3410700_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3410731_3411571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3411697_3413170_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3413172_3414663_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3414775_3415075_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_024901104.1|3415440_3416484_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3416603_3417677_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3417673_3418186_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3418369_3420778_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3420789_3421938_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3422302_3423079_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3423075_3423861_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3424282_3424735_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3424754_3425387_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3425480_3426215_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3426682_3427366_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3427366_3429775_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3429776_3430367_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3430363_3431773_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3432142_3433000_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3433109_3433745_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3433865_3434849_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3434880_3435384_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3435612_3436803_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3436862_3437234_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3437444_3440054_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3440275_3441331_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3441780_3442797_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3442917_3443787_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3443824_3444229_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3444619_3445840_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_009918009.1|3446302_3446557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|3447156_3448276_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3448328_3448811_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3448807_3449092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3449164_3450256_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3450654_3451065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3451201_3452077_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3452087_3453200_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3453228_3454323_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|3454465_3455434_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|3455536_3456106_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3456698_3457247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3457510_3458959_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3458977_3460591_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3460750_3461692_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3461688_3462783_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3463184_3463601_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3463786_3464341_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3464718_3465838_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009726	Burkholderia mallei strain Turkey1 chromosome 2, complete sequence	2120306	278554	330844	2120306	portal,integrase,transposase	Leptospira_phage(25.0%)	47	302998:303017	320938:320957
WP_004190269.1|278554_279559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004190833.1|281556_282636_+	putative membrane protein	NA	NA	NA	NA	NA
WP_038802950.1|282701_283821_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004190721.1|283849_284737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195671.1|284919_285246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533441.1|285476_286331_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190802.1|286426_287020_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004195676.1|287261_287672_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190743.1|287924_289163_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004190434.1|289227_289683_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190582.1|290967_292611_+	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190469.1|292769_293399_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190954.1|293395_294736_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190659.1|294821_295601_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190540.1|295693_296614_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004190343.1|296680_297556_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190990.1|297653_298037_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_004195687.1|298234_300157_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190826.1|300191_301040_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004190506.1|301583_302285_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190258.1|302286_302961_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195689.1|302973_303774_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
302998:303017	attL	CTTGAAGCCGTACTTCGCGA	NA	NA	NA	NA
WP_004204469.1|304214_304913_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004190691.1|305163_306312_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004190391.1|306408_306567_+	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_011832128.1|306679_307099_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190487.1|307236_307689_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038730270.1|307808_308060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190835.1|308191_309004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|308994_309990_-	homoserine kinase	NA	NA	NA	NA	NA
WP_004190726.1|310083_310482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190957.1|310637_312164_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004195697.1|312247_312934_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_009950031.1|312930_313218_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_096325434.1|313774_314895_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004203322.1|316799_317063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|317498_317990_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004190916.1|318649_318934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190924.1|319085_319355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|319351_320101_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190446.1|320102_322883_+	DNA polymerase I	NA	A0A1J0GVZ7	Streptomyces_phage	31.0	5.6e-51
320938:320957	attR	TCGCGAAGTACGGCTTCAAG	NA	NA	NA	NA
WP_004190401.1|323201_324584_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038763983.1|324945_326739_-	membrane protein	NA	NA	NA	NA	NA
WP_004204467.1|327078_327300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|327452_328328_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|328386_329256_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_004191998.1|329380_330844_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 2
NZ_CP009726	Burkholderia mallei strain Turkey1 chromosome 2, complete sequence	2120306	399653	449249	2120306	transposase,plate	Leptospira_phage(16.67%)	38	NA	NA
WP_004190585.1|399653_401057_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|401072_402389_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|402391_406021_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011832136.1|406017_406923_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004190273.1|406907_407135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190797.1|407133_409731_+	protein kinase	NA	A7IVH4	Paramecium_bursaria_Chlorella_virus	25.1	1.0e-14
WP_004190988.1|409783_410863_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024901024.1|410925_411504_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|411496_413005_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|413064_413556_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|413574_414135_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|414139_416011_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|416007_417486_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004203276.1|417464_420119_+	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004203275.1|420115_422320_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|422394_423048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196154.1|422977_424036_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_096325451.1|424063_425184_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.6e-49
WP_045589205.1|425083_425845_-	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	34.4	1.2e-16
WP_011204340.1|425857_426838_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004190776.1|427354_428779_+	cytosine permease	NA	NA	NA	NA	NA
WP_004190245.1|428775_429714_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190461.1|429676_430354_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190588.1|430677_430821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190614.1|430809_432225_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_011204342.1|432423_432756_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190911.1|433200_433512_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204344.1|433790_434555_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190805.1|434685_435321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190603.1|435589_436126_+	cytochrome b	NA	NA	NA	NA	NA
WP_004190837.1|436286_436682_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190808.1|436769_439007_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004196164.1|439357_440383_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004200631.1|441477_443007_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.2e-12
WP_004190757.1|443115_444216_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_004190781.1|444290_445337_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196172.1|445437_446697_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_096325434.1|448128_449249_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009726	Burkholderia mallei strain Turkey1 chromosome 2, complete sequence	2120306	1558838	1600273	2120306	transposase	Leptospira_phage(57.14%)	31	NA	NA
WP_038802950.1|1558838_1559958_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_038802333.1|1560827_1561948_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199588.1|1562093_1562504_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004198129.1|1562563_1563964_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004198128.1|1563960_1564803_-	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198127.1|1564862_1565192_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004266710.1|1565251_1565803_-	membrane protein	NA	NA	NA	NA	NA
WP_004199587.1|1566026_1568117_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004198124.1|1568404_1569604_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004191998.1|1569747_1571211_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004266709.1|1571415_1572204_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004198121.1|1572391_1573363_+	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004198120.1|1573511_1574357_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198119.1|1574369_1574648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204222.1|1574856_1576320_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198117.1|1576444_1576591_-	DUF3563 family protein	NA	NA	NA	NA	NA
WP_038802950.1|1576761_1577881_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_073699529.1|1583479_1583596_-	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_004194622.1|1584035_1584587_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004194628.1|1584591_1586046_-	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004199121.1|1586042_1587314_-	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194685.1|1587357_1588218_-	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004194612.1|1588207_1589155_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194602.1|1589132_1590230_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194640.1|1590286_1591369_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194610.1|1591606_1592716_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194588.1|1593117_1594464_-	MFS transporter	NA	NA	NA	NA	NA
WP_004194708.1|1594511_1595366_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004204041.1|1595362_1595818_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004198724.1|1596077_1598132_+	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1599153_1600273_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009726	Burkholderia mallei strain Turkey1 chromosome 2, complete sequence	2120306	1905907	1937533	2120306	transposase,plate	Streptococcus_phage(25.0%)	20	NA	NA
WP_004187303.1|1905907_1906993_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004187986.1|1906992_1908882_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004187068.1|1908912_1909494_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187921.1|1909480_1910446_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004188539.1|1910442_1911189_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_011204222.1|1912620_1914084_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004196243.1|1916241_1916823_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188012.1|1916857_1918357_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004188308.1|1918473_1918959_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004187276.1|1919065_1919569_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188743.1|1919590_1920937_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004188530.1|1921025_1922291_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188288.1|1926414_1926645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196246.1|1927230_1928577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187006.1|1928819_1929746_-	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004187502.1|1929800_1930772_-	quinone oxidoreductase	NA	A0A2P1ELD9	Moumouvirus	25.2	6.6e-07
WP_004187879.1|1930800_1932669_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	23.1	1.9e-18
WP_004187705.1|1932714_1934199_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004188150.1|1935124_1936183_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_004187628.1|1936312_1937533_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
